Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628497_at:

>probe:Drosophila_2:1628497_at:481:511; Interrogation_Position=1006; Antisense; GTGACAACAAGTTTGGCCAGTCCAA
>probe:Drosophila_2:1628497_at:550:591; Interrogation_Position=1069; Antisense; TGGGTTGGACCCACAATGCAGCTGT
>probe:Drosophila_2:1628497_at:35:537; Interrogation_Position=1122; Antisense; GGTCGCAATTGCTACGGTCAGCTGG
>probe:Drosophila_2:1628497_at:629:717; Interrogation_Position=1189; Antisense; TTCGCCTGAAGCTTCCTGAGGATCA
>probe:Drosophila_2:1628497_at:686:451; Interrogation_Position=1209; Antisense; GATCAGGGTCCTGCCAGAATTCACA
>probe:Drosophila_2:1628497_at:245:265; Interrogation_Position=1223; Antisense; CAGAATTCACATGGGCGCCGAGCAC
>probe:Drosophila_2:1628497_at:166:319; Interrogation_Position=1239; Antisense; GCCGAGCACGGTCTACTGAGGACTA
>probe:Drosophila_2:1628497_at:206:387; Interrogation_Position=1326; Antisense; GAAAATGTTTGCACCCCAACTCTTT
>probe:Drosophila_2:1628497_at:172:193; Interrogation_Position=1343; Antisense; AACTCTTTTACAACTGCCACCAGTG
>probe:Drosophila_2:1628497_at:399:129; Interrogation_Position=1361; Antisense; ACCAGTGAAATTGTGCGGCGCAGGA
>probe:Drosophila_2:1628497_at:179:699; Interrogation_Position=1392; Antisense; TTTTGTTACGCGATCACAGAGCCCG
>probe:Drosophila_2:1628497_at:566:697; Interrogation_Position=1426; Antisense; TTTAAGTCCATGTGATGTCCTTCTG
>probe:Drosophila_2:1628497_at:97:443; Interrogation_Position=1439; Antisense; GATGTCCTTCTGGTTTAGCTTATGA
>probe:Drosophila_2:1628497_at:110:367; Interrogation_Position=991; Antisense; GAATCCTTACCTTGGGTGACAACAA

Paste this into a BLAST search page for me
GTGACAACAAGTTTGGCCAGTCCAATGGGTTGGACCCACAATGCAGCTGTGGTCGCAATTGCTACGGTCAGCTGGTTCGCCTGAAGCTTCCTGAGGATCAGATCAGGGTCCTGCCAGAATTCACACAGAATTCACATGGGCGCCGAGCACGCCGAGCACGGTCTACTGAGGACTAGAAAATGTTTGCACCCCAACTCTTTAACTCTTTTACAACTGCCACCAGTGACCAGTGAAATTGTGCGGCGCAGGATTTTGTTACGCGATCACAGAGCCCGTTTAAGTCCATGTGATGTCCTTCTGGATGTCCTTCTGGTTTAGCTTATGAGAATCCTTACCTTGGGTGACAACAA

Full Affymetrix probeset data:

Annotations for 1628497_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime