FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628498_at:

>probe:Drosophila_2:1628498_at:384:251; Interrogation_Position=330; Antisense; CAAGGCGACCGGAGAGTGCACATAC
>probe:Drosophila_2:1628498_at:596:381; Interrogation_Position=404; Antisense; GAACGGAGGAGTGTCCCCGCCAGTT
>probe:Drosophila_2:1628498_at:239:99; Interrogation_Position=447; Antisense; AGATGCGACCAAGTGCGGCGTCTAT
>probe:Drosophila_2:1628498_at:674:197; Interrogation_Position=529; Antisense; AACGAGGAGACCTACCAGTGCGACT
>probe:Drosophila_2:1628498_at:672:325; Interrogation_Position=548; Antisense; GCGACTGGCCCGATCTAGTGGAAAG
>probe:Drosophila_2:1628498_at:550:583; Interrogation_Position=566; Antisense; TGGAAAGTTGCAACGCCGAGGCGTA
>probe:Drosophila_2:1628498_at:460:277; Interrogation_Position=582; Antisense; CGAGGCGTACCTGGGCTTCAATTGC
>probe:Drosophila_2:1628498_at:304:531; Interrogation_Position=663; Antisense; GGGTGAGCTGCGCTACTATCGCCAT
>probe:Drosophila_2:1628498_at:219:627; Interrogation_Position=687; Antisense; TCCCCAGACCTGCAAGAAGTACTTC
>probe:Drosophila_2:1628498_at:217:89; Interrogation_Position=704; Antisense; AGTACTTCGTGTGCGTCAACGGACA
>probe:Drosophila_2:1628498_at:330:321; Interrogation_Position=732; Antisense; GCGCCTGTACAACTGCGGCAAGTAT
>probe:Drosophila_2:1628498_at:712:217; Interrogation_Position=751; Antisense; AAGTATCTGGCCTTCAACTCGCAGA
>probe:Drosophila_2:1628498_at:266:391; Interrogation_Position=777; Antisense; GAAACTGTGCGACTTCTACAACAAG
>probe:Drosophila_2:1628498_at:73:279; Interrogation_Position=792; Antisense; CTACAACAAGGTGCCCGAGTGCTAT

Paste this into a BLAST search page for me
CAAGGCGACCGGAGAGTGCACATACGAACGGAGGAGTGTCCCCGCCAGTTAGATGCGACCAAGTGCGGCGTCTATAACGAGGAGACCTACCAGTGCGACTGCGACTGGCCCGATCTAGTGGAAAGTGGAAAGTTGCAACGCCGAGGCGTACGAGGCGTACCTGGGCTTCAATTGCGGGTGAGCTGCGCTACTATCGCCATTCCCCAGACCTGCAAGAAGTACTTCAGTACTTCGTGTGCGTCAACGGACAGCGCCTGTACAACTGCGGCAAGTATAAGTATCTGGCCTTCAACTCGCAGAGAAACTGTGCGACTTCTACAACAAGCTACAACAAGGTGCCCGAGTGCTAT

Full Affymetrix probeset data:

Annotations for 1628498_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720