FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628500_at:

>probe:Drosophila_2:1628500_at:37:379; Interrogation_Position=1017; Antisense; GAAGCCAGTCATCCACATTGTGAAC
>probe:Drosophila_2:1628500_at:270:375; Interrogation_Position=1053; Antisense; GAAGACTCCTCTGAAGGTCGGCGTA
>probe:Drosophila_2:1628500_at:390:577; Interrogation_Position=1087; Antisense; GGCCTGGATTTGATTTGCGCCACAC
>probe:Drosophila_2:1628500_at:681:353; Interrogation_Position=1115; Antisense; GCACCGTCAACTGGATAGCCAAGCT
>probe:Drosophila_2:1628500_at:717:169; Interrogation_Position=1152; Antisense; AAAGGACGAGTACCTGGCTGCTCCA
>probe:Drosophila_2:1628500_at:12:229; Interrogation_Position=1180; Antisense; AATGGCATCACGGTGGATCGCATCT
>probe:Drosophila_2:1628500_at:269:451; Interrogation_Position=1195; Antisense; GATCGCATCTTGGAGGGCTATCAAA
>probe:Drosophila_2:1628500_at:144:221; Interrogation_Position=1257; Antisense; AAGTGGTCACATGGCTCCGGCGGAC
>probe:Drosophila_2:1628500_at:231:201; Interrogation_Position=1282; Antisense; AACCCTGCGGCTATGAGTCATGTAC
>probe:Drosophila_2:1628500_at:427:531; Interrogation_Position=775; Antisense; GGTGTGGACTTCTACAACGTGCTGA
>probe:Drosophila_2:1628500_at:638:427; Interrogation_Position=825; Antisense; GAGATCAAAGGCCTTGACCTCCGAA
>probe:Drosophila_2:1628500_at:534:211; Interrogation_Position=848; Antisense; AAGAACGTCTGTATCGCACCATGGT
>probe:Drosophila_2:1628500_at:507:105; Interrogation_Position=937; Antisense; GAAACCCTGGGTATACCTTCGAATG
>probe:Drosophila_2:1628500_at:483:593; Interrogation_Position=981; Antisense; TGGGACCACTTTTGACATCCACAGA

Paste this into a BLAST search page for me
GAAGCCAGTCATCCACATTGTGAACGAAGACTCCTCTGAAGGTCGGCGTAGGCCTGGATTTGATTTGCGCCACACGCACCGTCAACTGGATAGCCAAGCTAAAGGACGAGTACCTGGCTGCTCCAAATGGCATCACGGTGGATCGCATCTGATCGCATCTTGGAGGGCTATCAAAAAGTGGTCACATGGCTCCGGCGGACAACCCTGCGGCTATGAGTCATGTACGGTGTGGACTTCTACAACGTGCTGAGAGATCAAAGGCCTTGACCTCCGAAAAGAACGTCTGTATCGCACCATGGTGAAACCCTGGGTATACCTTCGAATGTGGGACCACTTTTGACATCCACAGA

Full Affymetrix probeset data:

Annotations for 1628500_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720