Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628503_at:

>probe:Drosophila_2:1628503_at:551:691; Interrogation_Position=1052; Antisense; TTTGGGACCCCGAGCTGAACATGAT
>probe:Drosophila_2:1628503_at:48:153; Interrogation_Position=1070; Antisense; ACATGATCGACGCATTGACCCGGGA
>probe:Drosophila_2:1628503_at:342:593; Interrogation_Position=1102; Antisense; TGGGAAATGTACCTGTGCGTGCAAA
>probe:Drosophila_2:1628503_at:667:85; Interrogation_Position=1229; Antisense; AGTGCAGCTCTAGGCGAAAACGAAA
>probe:Drosophila_2:1628503_at:594:375; Interrogation_Position=1269; Antisense; GAAGACCACTTCAATTTGCAAGCTA
>probe:Drosophila_2:1628503_at:123:393; Interrogation_Position=1295; Antisense; GAAATGCTCGAACTAACGGTACCTG
>probe:Drosophila_2:1628503_at:541:197; Interrogation_Position=1309; Antisense; AACGGTACCTGGACTGCTGGACTTT
>probe:Drosophila_2:1628503_at:345:129; Interrogation_Position=1321; Antisense; ACTGCTGGACTTTGGACTCGACCCG
>probe:Drosophila_2:1628503_at:309:269; Interrogation_Position=1348; Antisense; CATGCGTACAGAGGCCCATCGGAAA
>probe:Drosophila_2:1628503_at:446:577; Interrogation_Position=1360; Antisense; GGCCCATCGGAAACGGTGTCGACTT
>probe:Drosophila_2:1628503_at:546:7; Interrogation_Position=876; Antisense; ATTTCGCGATGTGAAGACCAACTTG
>probe:Drosophila_2:1628503_at:115:563; Interrogation_Position=954; Antisense; GGAACCAGAGTCCTACTGGCTGAAT
>probe:Drosophila_2:1628503_at:130:47; Interrogation_Position=977; Antisense; ATCCGCTCTCATTCATTTTAGCCGA
>probe:Drosophila_2:1628503_at:165:707; Interrogation_Position=994; Antisense; TTAGCCGATATGTTCGACGACTTGG

Paste this into a BLAST search page for me
TTTGGGACCCCGAGCTGAACATGATACATGATCGACGCATTGACCCGGGATGGGAAATGTACCTGTGCGTGCAAAAGTGCAGCTCTAGGCGAAAACGAAAGAAGACCACTTCAATTTGCAAGCTAGAAATGCTCGAACTAACGGTACCTGAACGGTACCTGGACTGCTGGACTTTACTGCTGGACTTTGGACTCGACCCGCATGCGTACAGAGGCCCATCGGAAAGGCCCATCGGAAACGGTGTCGACTTATTTCGCGATGTGAAGACCAACTTGGGAACCAGAGTCCTACTGGCTGAATATCCGCTCTCATTCATTTTAGCCGATTAGCCGATATGTTCGACGACTTGG

Full Affymetrix probeset data:

Annotations for 1628503_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime