FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628504_at:

>probe:Drosophila_2:1628504_at:90:297; Interrogation_Position=284; Antisense; CGCATGAAGCGATTCCGATCCGAAG
>probe:Drosophila_2:1628504_at:443:677; Interrogation_Position=346; Antisense; TAGATCATCGAGTCTTTCGCGGCTA
>probe:Drosophila_2:1628504_at:339:649; Interrogation_Position=409; Antisense; TCAGACTTCGTGGACAGCAGCGGAC
>probe:Drosophila_2:1628504_at:347:135; Interrogation_Position=481; Antisense; ACGCGGCGGTGGTATCGATCTCGAA
>probe:Drosophila_2:1628504_at:65:559; Interrogation_Position=508; Antisense; GGACAAGCCCAGCAAGATCCAGCAG
>probe:Drosophila_2:1628504_at:606:351; Interrogation_Position=529; Antisense; GCAGCACACGATCCACATCGAGGTG
>probe:Drosophila_2:1628504_at:593:511; Interrogation_Position=560; Antisense; GTGACATCGGCCACGGCTATGCAAA
>probe:Drosophila_2:1628504_at:617:77; Interrogation_Position=612; Antisense; AGGTCCTTGTGCAGACGGCGGATAC
>probe:Drosophila_2:1628504_at:617:597; Interrogation_Position=640; Antisense; TGTCGCATTCGCCTCTATAATCGGC
>probe:Drosophila_2:1628504_at:709:661; Interrogation_Position=672; Antisense; TAACAGTGGCACTCTTCATTGTCCT
>probe:Drosophila_2:1628504_at:531:645; Interrogation_Position=687; Antisense; TCATTGTCCTGTGCCTGTGGTGCCT
>probe:Drosophila_2:1628504_at:640:595; Interrogation_Position=702; Antisense; TGTGGTGCCTTTACCTCTTACTAAG
>probe:Drosophila_2:1628504_at:177:359; Interrogation_Position=738; Antisense; GCAACTTGCAGACCAATGTCGGCAT
>probe:Drosophila_2:1628504_at:234:501; Interrogation_Position=755; Antisense; GTCGGCATGCCGTCCAAATAATTGT

Paste this into a BLAST search page for me
CGCATGAAGCGATTCCGATCCGAAGTAGATCATCGAGTCTTTCGCGGCTATCAGACTTCGTGGACAGCAGCGGACACGCGGCGGTGGTATCGATCTCGAAGGACAAGCCCAGCAAGATCCAGCAGGCAGCACACGATCCACATCGAGGTGGTGACATCGGCCACGGCTATGCAAAAGGTCCTTGTGCAGACGGCGGATACTGTCGCATTCGCCTCTATAATCGGCTAACAGTGGCACTCTTCATTGTCCTTCATTGTCCTGTGCCTGTGGTGCCTTGTGGTGCCTTTACCTCTTACTAAGGCAACTTGCAGACCAATGTCGGCATGTCGGCATGCCGTCCAAATAATTGT

Full Affymetrix probeset data:

Annotations for 1628504_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720