FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628505_at:

>probe:Drosophila_2:1628505_at:419:667; Interrogation_Position=1583; Antisense; TACATCCTGCTGGAGGTCAGTGCCA
>probe:Drosophila_2:1628505_at:474:323; Interrogation_Position=1611; Antisense; GCGACACCGTCAAGCAGCGTGTACT
>probe:Drosophila_2:1628505_at:697:119; Interrogation_Position=1626; Antisense; AGCGTGTACTGCAGATCCTTAACTT
>probe:Drosophila_2:1628505_at:296:625; Interrogation_Position=1650; Antisense; TGCGCGGCGCTTCCATGAAGACCAT
>probe:Drosophila_2:1628505_at:104:357; Interrogation_Position=1701; Antisense; GCAACCTGGGCGATGGCGACACCGA
>probe:Drosophila_2:1628505_at:440:379; Interrogation_Position=1744; Antisense; GAACCACATATTATCTCTAGTCGAT
>probe:Drosophila_2:1628505_at:248:679; Interrogation_Position=1761; Antisense; TAGTCGATCGTTTCTAAGGCTCAAC
>probe:Drosophila_2:1628505_at:97:181; Interrogation_Position=1914; Antisense; AAACAATGGCTTCCTTCTTTTTGAT
>probe:Drosophila_2:1628505_at:140:491; Interrogation_Position=1942; Antisense; GTAAGTCTCAAACACATCCGGCTCG
>probe:Drosophila_2:1628505_at:361:47; Interrogation_Position=1957; Antisense; ATCCGGCTCGATCCTGCATTGTTTA
>probe:Drosophila_2:1628505_at:150:707; Interrogation_Position=2008; Antisense; TTACCTTTCTTTTCGCAAATGTCTT
>probe:Drosophila_2:1628505_at:538:17; Interrogation_Position=2075; Antisense; ATTTCTTGTCATCTTTCTTCTCCGA
>probe:Drosophila_2:1628505_at:54:693; Interrogation_Position=2113; Antisense; TTACTGTCGGGCTGTTTTTGATCTT
>probe:Drosophila_2:1628505_at:343:703; Interrogation_Position=2128; Antisense; TTTTGATCTTTCTTGCAATCGCCCT

Paste this into a BLAST search page for me
TACATCCTGCTGGAGGTCAGTGCCAGCGACACCGTCAAGCAGCGTGTACTAGCGTGTACTGCAGATCCTTAACTTTGCGCGGCGCTTCCATGAAGACCATGCAACCTGGGCGATGGCGACACCGAGAACCACATATTATCTCTAGTCGATTAGTCGATCGTTTCTAAGGCTCAACAAACAATGGCTTCCTTCTTTTTGATGTAAGTCTCAAACACATCCGGCTCGATCCGGCTCGATCCTGCATTGTTTATTACCTTTCTTTTCGCAAATGTCTTATTTCTTGTCATCTTTCTTCTCCGATTACTGTCGGGCTGTTTTTGATCTTTTTTGATCTTTCTTGCAATCGCCCT

Full Affymetrix probeset data:

Annotations for 1628505_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720