FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628507_at:

>probe:Drosophila_2:1628507_at:226:125; Interrogation_Position=279; Antisense; AGCCGGTTCTGGGTTGGGCATAACT
>probe:Drosophila_2:1628507_at:25:661; Interrogation_Position=299; Antisense; TAACTTCGGATGCTCGTACTGAACC
>probe:Drosophila_2:1628507_at:573:125; Interrogation_Position=372; Antisense; AGCCGTTGCAGAGTTGGCCCTCAAG
>probe:Drosophila_2:1628507_at:725:33; Interrogation_Position=419; Antisense; ATCTCCTAAACAAGGCCGGCATTAA
>probe:Drosophila_2:1628507_at:72:69; Interrogation_Position=467; Antisense; AGGCTTATAGGAGGCGCGCGACCCA
>probe:Drosophila_2:1628507_at:600:661; Interrogation_Position=524; Antisense; TAAAACGGTGCCAGCAGACCTGCGA
>probe:Drosophila_2:1628507_at:688:465; Interrogation_Position=552; Antisense; GTTGGATCTTAAGTCCGCTATCACA
>probe:Drosophila_2:1628507_at:472:39; Interrogation_Position=584; Antisense; ATCTCGATTTCTTTTGGCCACCTAA
>probe:Drosophila_2:1628507_at:244:99; Interrogation_Position=621; Antisense; AGATGAATCACAGAGCGACGCCGAC
>probe:Drosophila_2:1628507_at:509:447; Interrogation_Position=646; Antisense; GATCCTGAAGTCGAGGTGCCACCTA
>probe:Drosophila_2:1628507_at:236:111; Interrogation_Position=695; Antisense; AGCAATTAGAACTCCTCACTGGCTA
>probe:Drosophila_2:1628507_at:647:7; Interrogation_Position=734; Antisense; ATTGCTTCTGCTATTGGTGTGGGAC
>probe:Drosophila_2:1628507_at:199:517; Interrogation_Position=752; Antisense; GTGGGACCCATTACGATGACGCCGA
>probe:Drosophila_2:1628507_at:456:55; Interrogation_Position=767; Antisense; ATGACGCCGAAGATCTGGGCTCCAA

Paste this into a BLAST search page for me
AGCCGGTTCTGGGTTGGGCATAACTTAACTTCGGATGCTCGTACTGAACCAGCCGTTGCAGAGTTGGCCCTCAAGATCTCCTAAACAAGGCCGGCATTAAAGGCTTATAGGAGGCGCGCGACCCATAAAACGGTGCCAGCAGACCTGCGAGTTGGATCTTAAGTCCGCTATCACAATCTCGATTTCTTTTGGCCACCTAAAGATGAATCACAGAGCGACGCCGACGATCCTGAAGTCGAGGTGCCACCTAAGCAATTAGAACTCCTCACTGGCTAATTGCTTCTGCTATTGGTGTGGGACGTGGGACCCATTACGATGACGCCGAATGACGCCGAAGATCTGGGCTCCAA

Full Affymetrix probeset data:

Annotations for 1628507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720