FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628508_at:

>probe:Drosophila_2:1628508_at:152:625; Interrogation_Position=151; Antisense; TGCGAATTAGCTGGCCAACTCTACA
>probe:Drosophila_2:1628508_at:264:193; Interrogation_Position=167; Antisense; AACTCTACATACTGGATGTCCCGAA
>probe:Drosophila_2:1628508_at:475:561; Interrogation_Position=195; Antisense; GGAATTACCCCTATGGCTTTGTATT
>probe:Drosophila_2:1628508_at:720:461; Interrogation_Position=236; Antisense; GATTCAACACGCACGTTGTGGGCCA
>probe:Drosophila_2:1628508_at:649:447; Interrogation_Position=275; Antisense; GATCCCGGGATTACGGACTGTTCCA
>probe:Drosophila_2:1628508_at:111:407; Interrogation_Position=290; Antisense; GACTGTTCCAAATCAGCGATCGCTA
>probe:Drosophila_2:1628508_at:42:517; Interrogation_Position=318; Antisense; GTGTGCGCCGCCAAATCGAACGGAA
>probe:Drosophila_2:1628508_at:308:615; Interrogation_Position=368; Antisense; TGAATTGCACTCACCTTCTGAGCGA
>probe:Drosophila_2:1628508_at:248:715; Interrogation_Position=383; Antisense; TTCTGAGCGACGACATCACCATGGC
>probe:Drosophila_2:1628508_at:210:125; Interrogation_Position=46; Antisense; AGCCCGCTTGGAATGGTCCGATCAA
>probe:Drosophila_2:1628508_at:212:271; Interrogation_Position=495; Antisense; CATCGATGTGTGTTTCCAGCCAGGA
>probe:Drosophila_2:1628508_at:102:391; Interrogation_Position=518; Antisense; GAAACGCCACAGAATCCATGACCAG
>probe:Drosophila_2:1628508_at:511:457; Interrogation_Position=575; Antisense; GATAGTCTGCCCATTAGGTCATCAC
>probe:Drosophila_2:1628508_at:178:171; Interrogation_Position=79; Antisense; AAAGTGAGAGTACTCCCGTTGCTGT

Paste this into a BLAST search page for me
TGCGAATTAGCTGGCCAACTCTACAAACTCTACATACTGGATGTCCCGAAGGAATTACCCCTATGGCTTTGTATTGATTCAACACGCACGTTGTGGGCCAGATCCCGGGATTACGGACTGTTCCAGACTGTTCCAAATCAGCGATCGCTAGTGTGCGCCGCCAAATCGAACGGAATGAATTGCACTCACCTTCTGAGCGATTCTGAGCGACGACATCACCATGGCAGCCCGCTTGGAATGGTCCGATCAACATCGATGTGTGTTTCCAGCCAGGAGAAACGCCACAGAATCCATGACCAGGATAGTCTGCCCATTAGGTCATCACAAAGTGAGAGTACTCCCGTTGCTGT

Full Affymetrix probeset data:

Annotations for 1628508_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720