FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628509_at:

>probe:Drosophila_2:1628509_at:491:643; Interrogation_Position=2034; Antisense; TCTACGGAGCTGTGAAGATCGACTA
>probe:Drosophila_2:1628509_at:519:97; Interrogation_Position=2049; Antisense; AGATCGACTAAGCTGTGTCACCCAC
>probe:Drosophila_2:1628509_at:580:331; Interrogation_Position=2081; Antisense; GCTGTACACCAAACTATCCTTGCAA
>probe:Drosophila_2:1628509_at:670:47; Interrogation_Position=2096; Antisense; ATCCTTGCAATATCATTCGATCATA
>probe:Drosophila_2:1628509_at:715:497; Interrogation_Position=2148; Antisense; GTCTCGTCCAGCTGCAGAAATCAAT
>probe:Drosophila_2:1628509_at:8:183; Interrogation_Position=2196; Antisense; AAAACTCGACGACTCAGCCATGTGA
>probe:Drosophila_2:1628509_at:27:63; Interrogation_Position=2215; Antisense; ATGTGAGCTAACTTCCCCTTCTTGT
>probe:Drosophila_2:1628509_at:242:643; Interrogation_Position=2234; Antisense; TCTTGTCCCCAGCTGCAGAAAGTCA
>probe:Drosophila_2:1628509_at:698:389; Interrogation_Position=2251; Antisense; GAAAGTCACCCACTAAGTAACCATT
>probe:Drosophila_2:1628509_at:622:647; Interrogation_Position=2297; Antisense; TCAGCAAGTACGTTTTGGAACCCCG
>probe:Drosophila_2:1628509_at:232:561; Interrogation_Position=2313; Antisense; GGAACCCCGGAAGTGACTCGATTTG
>probe:Drosophila_2:1628509_at:691:143; Interrogation_Position=2328; Antisense; ACTCGATTTGCAGGAGCGTGAGCGT
>probe:Drosophila_2:1628509_at:692:121; Interrogation_Position=2342; Antisense; AGCGTGAGCGTTGCGTTTTAGAATC
>probe:Drosophila_2:1628509_at:402:133; Interrogation_Position=2448; Antisense; ACTAAGCTTAATGTACGACACACCG

Paste this into a BLAST search page for me
TCTACGGAGCTGTGAAGATCGACTAAGATCGACTAAGCTGTGTCACCCACGCTGTACACCAAACTATCCTTGCAAATCCTTGCAATATCATTCGATCATAGTCTCGTCCAGCTGCAGAAATCAATAAAACTCGACGACTCAGCCATGTGAATGTGAGCTAACTTCCCCTTCTTGTTCTTGTCCCCAGCTGCAGAAAGTCAGAAAGTCACCCACTAAGTAACCATTTCAGCAAGTACGTTTTGGAACCCCGGGAACCCCGGAAGTGACTCGATTTGACTCGATTTGCAGGAGCGTGAGCGTAGCGTGAGCGTTGCGTTTTAGAATCACTAAGCTTAATGTACGACACACCG

Full Affymetrix probeset data:

Annotations for 1628509_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720