Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628512_at:

>probe:Drosophila_2:1628512_at:197:671; Interrogation_Position=1974; Antisense; TACGGCTCTGCCTTAGAATCGCTTT
>probe:Drosophila_2:1628512_at:228:695; Interrogation_Position=1996; Antisense; TTTCCAATTCAAGTCGCTCGAGCGA
>probe:Drosophila_2:1628512_at:172:325; Interrogation_Position=2017; Antisense; GCGAAAAGACTAACTCTACGGCAGG
>probe:Drosophila_2:1628512_at:463:279; Interrogation_Position=2032; Antisense; CTACGGCAGGAGACAGTGAGTTCAT
>probe:Drosophila_2:1628512_at:489:511; Interrogation_Position=2047; Antisense; GTGAGTTCATAATTGTCGCGAGCGA
>probe:Drosophila_2:1628512_at:438:213; Interrogation_Position=2077; Antisense; AAGAGCAGGCTGCTTCCTCTGAGGA
>probe:Drosophila_2:1628512_at:101:721; Interrogation_Position=2090; Antisense; TTCCTCTGAGGAGCAACGCGAAGAA
>probe:Drosophila_2:1628512_at:433:359; Interrogation_Position=2161; Antisense; GCAACGCCACTGAAGCTACCAAAGT
>probe:Drosophila_2:1628512_at:465:707; Interrogation_Position=2192; Antisense; TTAACTCTCGGAAACATTGCAATTG
>probe:Drosophila_2:1628512_at:274:183; Interrogation_Position=2276; Antisense; AAAATCGCGAACAGCTTTTGCAGCA
>probe:Drosophila_2:1628512_at:636:383; Interrogation_Position=2419; Antisense; GAACTTGTATGTTTAATCCCATGTG
>probe:Drosophila_2:1628512_at:283:631; Interrogation_Position=2435; Antisense; TCCCATGTGATTGCATTGACCGGCT
>probe:Drosophila_2:1628512_at:110:611; Interrogation_Position=2451; Antisense; TGACCGGCTGGATTTCATCGCTAAA
>probe:Drosophila_2:1628512_at:42:211; Interrogation_Position=2480; Antisense; AAGCAAATCTCGCACCCAAATAAAT

Paste this into a BLAST search page for me
TACGGCTCTGCCTTAGAATCGCTTTTTTCCAATTCAAGTCGCTCGAGCGAGCGAAAAGACTAACTCTACGGCAGGCTACGGCAGGAGACAGTGAGTTCATGTGAGTTCATAATTGTCGCGAGCGAAAGAGCAGGCTGCTTCCTCTGAGGATTCCTCTGAGGAGCAACGCGAAGAAGCAACGCCACTGAAGCTACCAAAGTTTAACTCTCGGAAACATTGCAATTGAAAATCGCGAACAGCTTTTGCAGCAGAACTTGTATGTTTAATCCCATGTGTCCCATGTGATTGCATTGACCGGCTTGACCGGCTGGATTTCATCGCTAAAAAGCAAATCTCGCACCCAAATAAAT

Full Affymetrix probeset data:

Annotations for 1628512_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime