FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628514_at:

>probe:Drosophila_2:1628514_at:707:109; Interrogation_Position=1009; Antisense; AGAAGTCGTCCAATCAATACTCCAC
>probe:Drosophila_2:1628514_at:690:703; Interrogation_Position=1133; Antisense; TTAGTCCACAGTAGATACCCATCCG
>probe:Drosophila_2:1628514_at:196:561; Interrogation_Position=1163; Antisense; GGAACACGGGCGGAGCTACTCTAAA
>probe:Drosophila_2:1628514_at:374:69; Interrogation_Position=677; Antisense; ATGGCCCTGTTTTTCAATGCCAGCA
>probe:Drosophila_2:1628514_at:477:723; Interrogation_Position=743; Antisense; TTGAAGGAAGTACTCCGCCAGCTGC
>probe:Drosophila_2:1628514_at:695:91; Interrogation_Position=771; Antisense; AGATCCTAGCGTGGTTTCAACGGCA
>probe:Drosophila_2:1628514_at:151:19; Interrogation_Position=807; Antisense; ATTTCTATGCCAGTTCTTTGCTCAT
>probe:Drosophila_2:1628514_at:610:717; Interrogation_Position=824; Antisense; TTGCTCATCTGCTACGACTATTCAA
>probe:Drosophila_2:1628514_at:495:403; Interrogation_Position=839; Antisense; GACTATTCAAGACTGGCTGATCCCC
>probe:Drosophila_2:1628514_at:276:185; Interrogation_Position=891; Antisense; AAAATGATGATGACCCCGCCACTTG
>probe:Drosophila_2:1628514_at:664:605; Interrogation_Position=930; Antisense; TGATCGACTTTGCTCATGTTTACCC
>probe:Drosophila_2:1628514_at:324:19; Interrogation_Position=945; Antisense; ATGTTTACCCGGCAGAACAGGGCTT
>probe:Drosophila_2:1628514_at:313:83; Interrogation_Position=963; Antisense; AGGGCTTGCCGGACGAGAACTACAT
>probe:Drosophila_2:1628514_at:306:385; Interrogation_Position=979; Antisense; GAACTACATGTTCGGTCTCCAGAGC

Paste this into a BLAST search page for me
AGAAGTCGTCCAATCAATACTCCACTTAGTCCACAGTAGATACCCATCCGGGAACACGGGCGGAGCTACTCTAAAATGGCCCTGTTTTTCAATGCCAGCATTGAAGGAAGTACTCCGCCAGCTGCAGATCCTAGCGTGGTTTCAACGGCAATTTCTATGCCAGTTCTTTGCTCATTTGCTCATCTGCTACGACTATTCAAGACTATTCAAGACTGGCTGATCCCCAAAATGATGATGACCCCGCCACTTGTGATCGACTTTGCTCATGTTTACCCATGTTTACCCGGCAGAACAGGGCTTAGGGCTTGCCGGACGAGAACTACATGAACTACATGTTCGGTCTCCAGAGC

Full Affymetrix probeset data:

Annotations for 1628514_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720