Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628519_at:

>probe:Drosophila_2:1628519_at:572:51; Interrogation_Position=13; Antisense; ATGCGATTCCTCTGCGTACTGATCC
>probe:Drosophila_2:1628519_at:297:711; Interrogation_Position=168; Antisense; TTCTCCAACTTCGTCGTCGTCGAGT
>probe:Drosophila_2:1628519_at:527:637; Interrogation_Position=187; Antisense; TCGAGTTCCTCATCATCCACGGCGA
>probe:Drosophila_2:1628519_at:644:323; Interrogation_Position=208; Antisense; GCGACCACCACTACAACGACAGTTG
>probe:Drosophila_2:1628519_at:156:127; Interrogation_Position=250; Antisense; ACCACGGAGGCGTCCAGTTCATCAT
>probe:Drosophila_2:1628519_at:450:505; Interrogation_Position=261; Antisense; GTCCAGTTCATCATCGTCGAGCGAT
>probe:Drosophila_2:1628519_at:569:501; Interrogation_Position=276; Antisense; GTCGAGCGATAAGAAAGTTCGGCAC
>probe:Drosophila_2:1628519_at:416:169; Interrogation_Position=289; Antisense; AAAGTTCGGCACACGAGGCACTACG
>probe:Drosophila_2:1628519_at:226:157; Interrogation_Position=299; Antisense; ACACGAGGCACTACGTCAACCGGCG
>probe:Drosophila_2:1628519_at:150:651; Interrogation_Position=314; Antisense; TCAACCGGCGTCACAGGAAGGACAA
>probe:Drosophila_2:1628519_at:569:211; Interrogation_Position=388; Antisense; AAGAAAGTCCGACGCACCCGTCGCA
>probe:Drosophila_2:1628519_at:264:303; Interrogation_Position=396; Antisense; CCGACGCACCCGTCGCAGTGGTTAA
>probe:Drosophila_2:1628519_at:441:287; Interrogation_Position=49; Antisense; CTGGCAGTGGCTAGTTCAACTTCAT
>probe:Drosophila_2:1628519_at:23:653; Interrogation_Position=64; Antisense; TCAACTTCATCTACTTCACCTGCTT

Paste this into a BLAST search page for me
ATGCGATTCCTCTGCGTACTGATCCTTCTCCAACTTCGTCGTCGTCGAGTTCGAGTTCCTCATCATCCACGGCGAGCGACCACCACTACAACGACAGTTGACCACGGAGGCGTCCAGTTCATCATGTCCAGTTCATCATCGTCGAGCGATGTCGAGCGATAAGAAAGTTCGGCACAAAGTTCGGCACACGAGGCACTACGACACGAGGCACTACGTCAACCGGCGTCAACCGGCGTCACAGGAAGGACAAAAGAAAGTCCGACGCACCCGTCGCACCGACGCACCCGTCGCAGTGGTTAACTGGCAGTGGCTAGTTCAACTTCATTCAACTTCATCTACTTCACCTGCTT

Full Affymetrix probeset data:

Annotations for 1628519_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime