FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628521_at:

>probe:Drosophila_2:1628521_at:408:621; Interrogation_Position=1085; Antisense; TGCGCGTCCGCATAAATCCAAAGTA
>probe:Drosophila_2:1628521_at:360:687; Interrogation_Position=1108; Antisense; TATTTTCGGCCGACGGAGGTCGATC
>probe:Drosophila_2:1628521_at:54:411; Interrogation_Position=1144; Antisense; GACGCGTCCAAAGCCAATCGAGAGC
>probe:Drosophila_2:1628521_at:553:235; Interrogation_Position=1159; Antisense; AATCGAGAGCTAAACTGGACGCCTA
>probe:Drosophila_2:1628521_at:328:563; Interrogation_Position=1174; Antisense; TGGACGCCTAAAGTTACCTTCGTGG
>probe:Drosophila_2:1628521_at:378:165; Interrogation_Position=1245; Antisense; AAATCCAATCGCTTAAGGCCTACCT
>probe:Drosophila_2:1628521_at:693:117; Interrogation_Position=1277; Antisense; AGCTCGGACTGGGATCATTTACGGC
>probe:Drosophila_2:1628521_at:486:35; Interrogation_Position=1290; Antisense; ATCATTTACGGCACAAAGCTCTCTG
>probe:Drosophila_2:1628521_at:283:343; Interrogation_Position=1318; Antisense; GCTTGCGGAGCTATACACTAACCAT
>probe:Drosophila_2:1628521_at:723:249; Interrogation_Position=1379; Antisense; CAATGTATTTCTGTATTCTCGTGGG
>probe:Drosophila_2:1628521_at:688:237; Interrogation_Position=1411; Antisense; AATCATTCCTTTTTCTACTTTGCCG
>probe:Drosophila_2:1628521_at:407:319; Interrogation_Position=1432; Antisense; GCCGCGTACGTTCATGTTCAGTGTG
>probe:Drosophila_2:1628521_at:645:715; Interrogation_Position=945; Antisense; TTCCGACTACGTCATAGCTACAGGC
>probe:Drosophila_2:1628521_at:209:521; Interrogation_Position=994; Antisense; GTGGAAGCCGCGTTCAAGCATATTG

Paste this into a BLAST search page for me
TGCGCGTCCGCATAAATCCAAAGTATATTTTCGGCCGACGGAGGTCGATCGACGCGTCCAAAGCCAATCGAGAGCAATCGAGAGCTAAACTGGACGCCTATGGACGCCTAAAGTTACCTTCGTGGAAATCCAATCGCTTAAGGCCTACCTAGCTCGGACTGGGATCATTTACGGCATCATTTACGGCACAAAGCTCTCTGGCTTGCGGAGCTATACACTAACCATCAATGTATTTCTGTATTCTCGTGGGAATCATTCCTTTTTCTACTTTGCCGGCCGCGTACGTTCATGTTCAGTGTGTTCCGACTACGTCATAGCTACAGGCGTGGAAGCCGCGTTCAAGCATATTG

Full Affymetrix probeset data:

Annotations for 1628521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720