FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628524_at:

>probe:Drosophila_2:1628524_at:496:509; Interrogation_Position=122; Antisense; GTGCTTCGGTCAAAGCAGGCTCTAC
>probe:Drosophila_2:1628524_at:145:179; Interrogation_Position=147; Antisense; AAACTATATGCCTGCGGTGGTGCCC
>probe:Drosophila_2:1628524_at:446:493; Interrogation_Position=175; Antisense; GTCACGAATTCCGAAATGGTCTTCA
>probe:Drosophila_2:1628524_at:607:249; Interrogation_Position=198; Antisense; CAAGGAAGCGGCTGCCCACGCAGTG
>probe:Drosophila_2:1628524_at:33:77; Interrogation_Position=234; Antisense; AGGATCAGTCGTGGGTCATGCCATC
>probe:Drosophila_2:1628524_at:571:531; Interrogation_Position=246; Antisense; GGGTCATGCCATCGGATCAGGAATA
>probe:Drosophila_2:1628524_at:477:689; Interrogation_Position=278; Antisense; TATTCAGGCGGCGTGACCAGCAGCC
>probe:Drosophila_2:1628524_at:522:125; Interrogation_Position=299; Antisense; AGCCGCACCACAGCGATTTAGTCGA
>probe:Drosophila_2:1628524_at:719:549; Interrogation_Position=351; Antisense; GGAGTTCTTGAAGTGCACCGAGGAC
>probe:Drosophila_2:1628524_at:353:397; Interrogation_Position=373; Antisense; GACAATGACGATCTCAGTGTGTGCA
>probe:Drosophila_2:1628524_at:523:429; Interrogation_Position=400; Antisense; GAGTTCAACGATGCTGTGCGACGAT
>probe:Drosophila_2:1628524_at:432:217; Interrogation_Position=41; Antisense; AAGTCTAATTCTGCTCGGCTTAAAA
>probe:Drosophila_2:1628524_at:556:447; Interrogation_Position=422; Antisense; GATGCCACCGCCAGTACAATATTTA
>probe:Drosophila_2:1628524_at:232:405; Interrogation_Position=490; Antisense; GACGTTAATGCGCAGCCTTACAAGT

Paste this into a BLAST search page for me
GTGCTTCGGTCAAAGCAGGCTCTACAAACTATATGCCTGCGGTGGTGCCCGTCACGAATTCCGAAATGGTCTTCACAAGGAAGCGGCTGCCCACGCAGTGAGGATCAGTCGTGGGTCATGCCATCGGGTCATGCCATCGGATCAGGAATATATTCAGGCGGCGTGACCAGCAGCCAGCCGCACCACAGCGATTTAGTCGAGGAGTTCTTGAAGTGCACCGAGGACGACAATGACGATCTCAGTGTGTGCAGAGTTCAACGATGCTGTGCGACGATAAGTCTAATTCTGCTCGGCTTAAAAGATGCCACCGCCAGTACAATATTTAGACGTTAATGCGCAGCCTTACAAGT

Full Affymetrix probeset data:

Annotations for 1628524_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720