FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628525_at:

>probe:Drosophila_2:1628525_at:52:361; Interrogation_Position=1035; Antisense; GCAACCAGGTTCCTCCGCGGGAGAA
>probe:Drosophila_2:1628525_at:609:251; Interrogation_Position=1072; Antisense; CAAGATCCGATCTGCCAGCAAGGAT
>probe:Drosophila_2:1628525_at:291:223; Interrogation_Position=1091; Antisense; AAGGATATAGCCACGCCATCGACCA
>probe:Drosophila_2:1628525_at:42:717; Interrogation_Position=1138; Antisense; TTCGAAGCCCAGCAGACAAACGGTC
>probe:Drosophila_2:1628525_at:507:179; Interrogation_Position=1163; Antisense; AAACATCCATTCAAGGCGGTGGCCT
>probe:Drosophila_2:1628525_at:377:283; Interrogation_Position=1186; Antisense; CTCCACCCATGTAAGGCTGCAGAAG
>probe:Drosophila_2:1628525_at:552:485; Interrogation_Position=1255; Antisense; GTAGAGTTCCTAGAGCTCACATCAG
>probe:Drosophila_2:1628525_at:509:339; Interrogation_Position=1269; Antisense; GCTCACATCAGTATTGCAGGCACAT
>probe:Drosophila_2:1628525_at:256:583; Interrogation_Position=747; Antisense; TGGCTTCCAGGAAAACTGCACTCAA
>probe:Drosophila_2:1628525_at:400:623; Interrogation_Position=780; Antisense; TGCGCTCCCAGTCGATGGATAGCTT
>probe:Drosophila_2:1628525_at:502:25; Interrogation_Position=798; Antisense; ATAGCTTGGAGCACGAGCACCTGGT
>probe:Drosophila_2:1628525_at:408:353; Interrogation_Position=814; Antisense; GCACCTGGTCAGTCCGCTCAAGAGG
>probe:Drosophila_2:1628525_at:724:213; Interrogation_Position=833; Antisense; AAGAGGCGCCCGAAGTTGTCCAGGA
>probe:Drosophila_2:1628525_at:40:409; Interrogation_Position=871; Antisense; GACGGGAGCCGGAATCAATCATGGA

Paste this into a BLAST search page for me
GCAACCAGGTTCCTCCGCGGGAGAACAAGATCCGATCTGCCAGCAAGGATAAGGATATAGCCACGCCATCGACCATTCGAAGCCCAGCAGACAAACGGTCAAACATCCATTCAAGGCGGTGGCCTCTCCACCCATGTAAGGCTGCAGAAGGTAGAGTTCCTAGAGCTCACATCAGGCTCACATCAGTATTGCAGGCACATTGGCTTCCAGGAAAACTGCACTCAATGCGCTCCCAGTCGATGGATAGCTTATAGCTTGGAGCACGAGCACCTGGTGCACCTGGTCAGTCCGCTCAAGAGGAAGAGGCGCCCGAAGTTGTCCAGGAGACGGGAGCCGGAATCAATCATGGA

Full Affymetrix probeset data:

Annotations for 1628525_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720