Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628526_at:

>probe:Drosophila_2:1628526_at:318:273; Interrogation_Position=1000; Antisense; CATTTTCTCGAGTACTTTGTGCAGG
>probe:Drosophila_2:1628526_at:76:509; Interrogation_Position=1018; Antisense; GTGCAGGAATCGCTGTCACTGCGAC
>probe:Drosophila_2:1628526_at:488:69; Interrogation_Position=1067; Antisense; AGGCGGTGGCCTCCAACATAATGTT
>probe:Drosophila_2:1628526_at:135:301; Interrogation_Position=1126; Antisense; CCGGGTCCTTCGATGGTCCAGAGAT
>probe:Drosophila_2:1628526_at:717:363; Interrogation_Position=1167; Antisense; GAATATCGTCCGGAATCTGAGCAAC
>probe:Drosophila_2:1628526_at:372:341; Interrogation_Position=1213; Antisense; GCTTTAGCCGCCATTTAGATTTTTA
>probe:Drosophila_2:1628526_at:674:23; Interrogation_Position=1244; Antisense; ATATGGCCAAGGACACTGATCTCGG
>probe:Drosophila_2:1628526_at:603:631; Interrogation_Position=1279; Antisense; TCCGTCGTTCAAAGTCCTGGACATG
>probe:Drosophila_2:1628526_at:622:397; Interrogation_Position=1298; Antisense; GACATGCCAACTCCGGTGAACTGGA
>probe:Drosophila_2:1628526_at:82:591; Interrogation_Position=785; Antisense; TGGTTCACTGCGACGAGCTGAGCTC
>probe:Drosophila_2:1628526_at:543:499; Interrogation_Position=834; Antisense; GTCGGAGGAGCAATCGTCCAGCCAA
>probe:Drosophila_2:1628526_at:564:499; Interrogation_Position=879; Antisense; GTCTGGAAATTCAAGCTCGCTGTGC
>probe:Drosophila_2:1628526_at:664:23; Interrogation_Position=946; Antisense; ATATGCGAACTACCCTCGGAGTTGG
>probe:Drosophila_2:1628526_at:141:427; Interrogation_Position=964; Antisense; GAGTTGGACGAATCCATTGCCCATT

Paste this into a BLAST search page for me
CATTTTCTCGAGTACTTTGTGCAGGGTGCAGGAATCGCTGTCACTGCGACAGGCGGTGGCCTCCAACATAATGTTCCGGGTCCTTCGATGGTCCAGAGATGAATATCGTCCGGAATCTGAGCAACGCTTTAGCCGCCATTTAGATTTTTAATATGGCCAAGGACACTGATCTCGGTCCGTCGTTCAAAGTCCTGGACATGGACATGCCAACTCCGGTGAACTGGATGGTTCACTGCGACGAGCTGAGCTCGTCGGAGGAGCAATCGTCCAGCCAAGTCTGGAAATTCAAGCTCGCTGTGCATATGCGAACTACCCTCGGAGTTGGGAGTTGGACGAATCCATTGCCCATT

Full Affymetrix probeset data:

Annotations for 1628526_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime