FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628528_at:

>probe:Drosophila_2:1628528_at:611:387; Interrogation_Position=394; Antisense; GAAAACTTTAACCTCCAGCGCGGCT
>probe:Drosophila_2:1628528_at:67:125; Interrogation_Position=410; Antisense; AGCGCGGCTTTGTCACTGTTTGATC
>probe:Drosophila_2:1628528_at:106:155; Interrogation_Position=459; Antisense; ACAGTTTGACAATTGGCGCCGGCGT
>probe:Drosophila_2:1628528_at:164:573; Interrogation_Position=479; Antisense; GGCGTCGGCAACAACAGTAGCCCAG
>probe:Drosophila_2:1628528_at:457:497; Interrogation_Position=604; Antisense; GTCTCTGTCCTCCAATATTGAACTG
>probe:Drosophila_2:1628528_at:150:149; Interrogation_Position=671; Antisense; ACTATTGGAATCGTGCAGGGTACCA
>probe:Drosophila_2:1628528_at:312:529; Interrogation_Position=722; Antisense; GGGTTTGGAGCCCAAGCCGCCAAAT
>probe:Drosophila_2:1628528_at:120:175; Interrogation_Position=754; Antisense; AAACGCATTGCGATCTCAGCTCTAC
>probe:Drosophila_2:1628528_at:655:671; Interrogation_Position=776; Antisense; TACCAGGGCGCCAGGAAGACTGCAA
>probe:Drosophila_2:1628528_at:229:255; Interrogation_Position=801; Antisense; CAACATCTCGAGTGGGAGTCGGCAA
>probe:Drosophila_2:1628528_at:199:195; Interrogation_Position=832; Antisense; AACGGTGGCAACAGCCCCAAGAACA
>probe:Drosophila_2:1628528_at:112:493; Interrogation_Position=897; Antisense; GTCTAGATCGGTACGACTCGTCGGA
>probe:Drosophila_2:1628528_at:481:405; Interrogation_Position=911; Antisense; GACTCGTCGGAGTCATCAGACAGGT
>probe:Drosophila_2:1628528_at:195:433; Interrogation_Position=936; Antisense; GAGTGCATGTCGTGGGCACACTACT

Paste this into a BLAST search page for me
GAAAACTTTAACCTCCAGCGCGGCTAGCGCGGCTTTGTCACTGTTTGATCACAGTTTGACAATTGGCGCCGGCGTGGCGTCGGCAACAACAGTAGCCCAGGTCTCTGTCCTCCAATATTGAACTGACTATTGGAATCGTGCAGGGTACCAGGGTTTGGAGCCCAAGCCGCCAAATAAACGCATTGCGATCTCAGCTCTACTACCAGGGCGCCAGGAAGACTGCAACAACATCTCGAGTGGGAGTCGGCAAAACGGTGGCAACAGCCCCAAGAACAGTCTAGATCGGTACGACTCGTCGGAGACTCGTCGGAGTCATCAGACAGGTGAGTGCATGTCGTGGGCACACTACT

Full Affymetrix probeset data:

Annotations for 1628528_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720