FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628530_at:

>probe:Drosophila_2:1628530_at:707:583; Interrogation_Position=254; Antisense; TGGCAGACTACCTTTTCTCCAAAAA
>probe:Drosophila_2:1628530_at:419:669; Interrogation_Position=398; Antisense; TACTGAAGCTGATCCGCGGCAATGT
>probe:Drosophila_2:1628530_at:416:301; Interrogation_Position=444; Antisense; CCGCGCTACGATATCAGTTCTGGAG
>probe:Drosophila_2:1628530_at:440:715; Interrogation_Position=461; Antisense; TTCTGGAGTTTGATTTTCTCGCCTC
>probe:Drosophila_2:1628530_at:399:459; Interrogation_Position=532; Antisense; GATATAATCCTAGCTGCCGATGTCA
>probe:Drosophila_2:1628530_at:330:319; Interrogation_Position=547; Antisense; GCCGATGTCATCTACTGTGATACGC
>probe:Drosophila_2:1628530_at:404:513; Interrogation_Position=563; Antisense; GTGATACGCTAACCGATGCCTTCAT
>probe:Drosophila_2:1628530_at:606:49; Interrogation_Position=578; Antisense; ATGCCTTCATCTGCGTCTTGGATAA
>probe:Drosophila_2:1628530_at:322:497; Interrogation_Position=592; Antisense; GTCTTGGATAACCTCCTGGATCGAG
>probe:Drosophila_2:1628530_at:57:553; Interrogation_Position=657; Antisense; GGAGAAGCGCTATGTGTTCACACTG
>probe:Drosophila_2:1628530_at:49:437; Interrogation_Position=682; Antisense; GAGGATTGCGATTCGGTGGCTCCCA
>probe:Drosophila_2:1628530_at:346:521; Interrogation_Position=697; Antisense; GTGGCTCCCATGTATGAGTACCTCA
>probe:Drosophila_2:1628530_at:169:205; Interrogation_Position=739; Antisense; AAGCCGTGGATCATGGAGCACCTGC
>probe:Drosophila_2:1628530_at:1:451; Interrogation_Position=793; Antisense; GATCGCTGCAAGCAACTGGTTCTGA

Paste this into a BLAST search page for me
TGGCAGACTACCTTTTCTCCAAAAATACTGAAGCTGATCCGCGGCAATGTCCGCGCTACGATATCAGTTCTGGAGTTCTGGAGTTTGATTTTCTCGCCTCGATATAATCCTAGCTGCCGATGTCAGCCGATGTCATCTACTGTGATACGCGTGATACGCTAACCGATGCCTTCATATGCCTTCATCTGCGTCTTGGATAAGTCTTGGATAACCTCCTGGATCGAGGGAGAAGCGCTATGTGTTCACACTGGAGGATTGCGATTCGGTGGCTCCCAGTGGCTCCCATGTATGAGTACCTCAAAGCCGTGGATCATGGAGCACCTGCGATCGCTGCAAGCAACTGGTTCTGA

Full Affymetrix probeset data:

Annotations for 1628530_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720