FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628531_at:

>probe:Drosophila_2:1628531_at:210:115; Interrogation_Position=1032; Antisense; AGCAGGACCCCAAGCGGCATTTGGA
>probe:Drosophila_2:1628531_at:630:243; Interrogation_Position=1085; Antisense; AATATTGTGCAGTGCCTGGGCGCCA
>probe:Drosophila_2:1628531_at:111:17; Interrogation_Position=1136; Antisense; ATTTATGCATTTGCTCTCCTCAAAC
>probe:Drosophila_2:1628531_at:615:711; Interrogation_Position=1170; Antisense; TTCATACCCACAAATCGCTAAGCTA
>probe:Drosophila_2:1628531_at:427:355; Interrogation_Position=660; Antisense; GCAAAGTGGTCATCGATGCCTTCCG
>probe:Drosophila_2:1628531_at:589:605; Interrogation_Position=687; Antisense; TGATCAATCCCAACATGCTTGTGCT
>probe:Drosophila_2:1628531_at:405:567; Interrogation_Position=726; Antisense; GGCAGACAACCTCCAATTTGGGTCA
>probe:Drosophila_2:1628531_at:198:19; Interrogation_Position=741; Antisense; ATTTGGGTCATCTGCAAAAGCCCTC
>probe:Drosophila_2:1628531_at:252:633; Interrogation_Position=793; Antisense; TCGCCACTACTACTCGATTAGCATA
>probe:Drosophila_2:1628531_at:290:375; Interrogation_Position=844; Antisense; GAAGATGCTTCTCAATCTGCACAAA
>probe:Drosophila_2:1628531_at:287:139; Interrogation_Position=890; Antisense; ACGTTGTCCGACTACAATGAGCACT
>probe:Drosophila_2:1628531_at:589:231; Interrogation_Position=905; Antisense; AATGAGCACTGTTCCATCAACGAGG
>probe:Drosophila_2:1628531_at:594:399; Interrogation_Position=929; Antisense; GACACCGTGGCCGAGATGCTGGATC
>probe:Drosophila_2:1628531_at:148:333; Interrogation_Position=946; Antisense; GCTGGATCTCGCCAAGAACTACAAC

Paste this into a BLAST search page for me
AGCAGGACCCCAAGCGGCATTTGGAAATATTGTGCAGTGCCTGGGCGCCAATTTATGCATTTGCTCTCCTCAAACTTCATACCCACAAATCGCTAAGCTAGCAAAGTGGTCATCGATGCCTTCCGTGATCAATCCCAACATGCTTGTGCTGGCAGACAACCTCCAATTTGGGTCAATTTGGGTCATCTGCAAAAGCCCTCTCGCCACTACTACTCGATTAGCATAGAAGATGCTTCTCAATCTGCACAAAACGTTGTCCGACTACAATGAGCACTAATGAGCACTGTTCCATCAACGAGGGACACCGTGGCCGAGATGCTGGATCGCTGGATCTCGCCAAGAACTACAAC

Full Affymetrix probeset data:

Annotations for 1628531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720