FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628532_at:

>probe:Drosophila_2:1628532_at:343:637; Interrogation_Position=120; Antisense; TCGATCGCACCGCAATATTGGCAAG
>probe:Drosophila_2:1628532_at:480:627; Interrogation_Position=218; Antisense; TGCCACTGCTGCTACTAATTACTGC
>probe:Drosophila_2:1628532_at:142:191; Interrogation_Position=267; Antisense; AACATATCTGGATTGGGCGCGCACC
>probe:Drosophila_2:1628532_at:298:323; Interrogation_Position=283; Antisense; GCGCGCACCGATAGTCAGCTAACGA
>probe:Drosophila_2:1628532_at:495:381; Interrogation_Position=306; Antisense; GAGACTACCATTCTTTGGCGGCGGT
>probe:Drosophila_2:1628532_at:208:593; Interrogation_Position=332; Antisense; TGGGTCACCTGCTGCGATATCTGCA
>probe:Drosophila_2:1628532_at:287:457; Interrogation_Position=347; Antisense; GATATCTGCACCCATTGTCGATGAG
>probe:Drosophila_2:1628532_at:459:165; Interrogation_Position=392; Antisense; AAATCTCGGAGCTACGCAGCGAATT
>probe:Drosophila_2:1628532_at:626:445; Interrogation_Position=418; Antisense; GATGCCAACTATGTGAGCTACCGTG
>probe:Drosophila_2:1628532_at:574:377; Interrogation_Position=456; Antisense; GAAGCTGAACTTCAATGCCACCCGG
>probe:Drosophila_2:1628532_at:159:649; Interrogation_Position=544; Antisense; TCACCGGATGCCCAATTCAATGAGG
>probe:Drosophila_2:1628532_at:406:519; Interrogation_Position=568; Antisense; GTGGTCGCATTATTCGGTGAGTCAA
>probe:Drosophila_2:1628532_at:638:425; Interrogation_Position=586; Antisense; GAGTCAAAACACATACCCCGGAGGG
>probe:Drosophila_2:1628532_at:173:219; Interrogation_Position=620; Antisense; AAGTCTGCCGTTCCACACAAAAGAA

Paste this into a BLAST search page for me
TCGATCGCACCGCAATATTGGCAAGTGCCACTGCTGCTACTAATTACTGCAACATATCTGGATTGGGCGCGCACCGCGCGCACCGATAGTCAGCTAACGAGAGACTACCATTCTTTGGCGGCGGTTGGGTCACCTGCTGCGATATCTGCAGATATCTGCACCCATTGTCGATGAGAAATCTCGGAGCTACGCAGCGAATTGATGCCAACTATGTGAGCTACCGTGGAAGCTGAACTTCAATGCCACCCGGTCACCGGATGCCCAATTCAATGAGGGTGGTCGCATTATTCGGTGAGTCAAGAGTCAAAACACATACCCCGGAGGGAAGTCTGCCGTTCCACACAAAAGAA

Full Affymetrix probeset data:

Annotations for 1628532_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720