FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628533_at:

>probe:Drosophila_2:1628533_at:521:251; Interrogation_Position=114; Antisense; CAAGAAGGAGTACCCTGCCTCGGAG
>probe:Drosophila_2:1628533_at:24:69; Interrogation_Position=137; Antisense; AGGCCTTCACCATTCCTTTGGAGAG
>probe:Drosophila_2:1628533_at:553:9; Interrogation_Position=148; Antisense; ATTCCTTTGGAGAGCGATGACGGTC
>probe:Drosophila_2:1628533_at:378:55; Interrogation_Position=164; Antisense; ATGACGGTCCGGAGATGCCGCTAAA
>probe:Drosophila_2:1628533_at:557:445; Interrogation_Position=177; Antisense; GATGCCGCTAAACGAGACGGTTCGC
>probe:Drosophila_2:1628533_at:184:425; Interrogation_Position=190; Antisense; GAGACGGTTCGCCAGCCACCGAAGA
>probe:Drosophila_2:1628533_at:15:313; Interrogation_Position=204; Antisense; GCCACCGAAGAGGATTCAGCAACTG
>probe:Drosophila_2:1628533_at:259:649; Interrogation_Position=219; Antisense; TCAGCAACTGATGCAGGAGGCGGCC
>probe:Drosophila_2:1628533_at:389:415; Interrogation_Position=250; Antisense; GAGCCACTCACCTTGGAGGAGCTGG
>probe:Drosophila_2:1628533_at:523:575; Interrogation_Position=302; Antisense; GGCGCCAGGAGCTCATGCAGCAGAA
>probe:Drosophila_2:1628533_at:294:369; Interrogation_Position=345; Antisense; GAATGCCCAGATGCTCATGAAGCCT
>probe:Drosophila_2:1628533_at:507:305; Interrogation_Position=367; Antisense; CCTCATGAGGAAACCGTTGGCGAAG
>probe:Drosophila_2:1628533_at:541:311; Interrogation_Position=40; Antisense; GCCACCGTAGAAGACACCAAATCAT
>probe:Drosophila_2:1628533_at:67:91; Interrogation_Position=94; Antisense; AGTACAACGAGAATGGCCGCCAAGA

Paste this into a BLAST search page for me
CAAGAAGGAGTACCCTGCCTCGGAGAGGCCTTCACCATTCCTTTGGAGAGATTCCTTTGGAGAGCGATGACGGTCATGACGGTCCGGAGATGCCGCTAAAGATGCCGCTAAACGAGACGGTTCGCGAGACGGTTCGCCAGCCACCGAAGAGCCACCGAAGAGGATTCAGCAACTGTCAGCAACTGATGCAGGAGGCGGCCGAGCCACTCACCTTGGAGGAGCTGGGGCGCCAGGAGCTCATGCAGCAGAAGAATGCCCAGATGCTCATGAAGCCTCCTCATGAGGAAACCGTTGGCGAAGGCCACCGTAGAAGACACCAAATCATAGTACAACGAGAATGGCCGCCAAGA

Full Affymetrix probeset data:

Annotations for 1628533_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720