Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628534_at:

>probe:Drosophila_2:1628534_at:325:357; Interrogation_Position=290; Antisense; GCAATCCCGAAAGAACAATCTCGTC
>probe:Drosophila_2:1628534_at:565:291; Interrogation_Position=450; Antisense; CGTCCTGAGCCGTAAGGATCCTGCT
>probe:Drosophila_2:1628534_at:611:125; Interrogation_Position=457; Antisense; AGCCGTAAGGATCCTGCTCCAAGAT
>probe:Drosophila_2:1628534_at:238:493; Interrogation_Position=461; Antisense; GTAAGGATCCTGCTCCAAGATCAGT
>probe:Drosophila_2:1628534_at:221:547; Interrogation_Position=465; Antisense; GGATCCTGCTCCAAGATCAGTCAAA
>probe:Drosophila_2:1628534_at:475:619; Interrogation_Position=471; Antisense; TGCTCCAAGATCAGTCAAAGTAGTT
>probe:Drosophila_2:1628534_at:555:207; Interrogation_Position=477; Antisense; AAGATCAGTCAAAGTAGTTAGGCAT
>probe:Drosophila_2:1628534_at:212:485; Interrogation_Position=490; Antisense; GTAGTTAGGCATGATATCCTGTAGA
>probe:Drosophila_2:1628534_at:321:71; Interrogation_Position=496; Antisense; AGGCATGATATCCTGTAGAGATACA
>probe:Drosophila_2:1628534_at:173:677; Interrogation_Position=511; Antisense; TAGAGATACACTACCAAGCCTGGCA
>probe:Drosophila_2:1628534_at:307:455; Interrogation_Position=515; Antisense; GATACACTACCAAGCCTGGCAGAGA
>probe:Drosophila_2:1628534_at:327:253; Interrogation_Position=525; Antisense; CAAGCCTGGCAGAGATCTACGATAT
>probe:Drosophila_2:1628534_at:432:287; Interrogation_Position=530; Antisense; CTGGCAGAGATCTACGATATGTATA
>probe:Drosophila_2:1628534_at:644:457; Interrogation_Position=545; Antisense; GATATGTATAGATAGATCAGTGCAA

Paste this into a BLAST search page for me
GCAATCCCGAAAGAACAATCTCGTCCGTCCTGAGCCGTAAGGATCCTGCTAGCCGTAAGGATCCTGCTCCAAGATGTAAGGATCCTGCTCCAAGATCAGTGGATCCTGCTCCAAGATCAGTCAAATGCTCCAAGATCAGTCAAAGTAGTTAAGATCAGTCAAAGTAGTTAGGCATGTAGTTAGGCATGATATCCTGTAGAAGGCATGATATCCTGTAGAGATACATAGAGATACACTACCAAGCCTGGCAGATACACTACCAAGCCTGGCAGAGACAAGCCTGGCAGAGATCTACGATATCTGGCAGAGATCTACGATATGTATAGATATGTATAGATAGATCAGTGCAA

Full Affymetrix probeset data:

Annotations for 1628534_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime