Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628535_at:

>probe:Drosophila_2:1628535_at:698:313; Interrogation_Position=1463; Antisense; GCCAGTGTCCTCTAAATGCGAGCCA
>probe:Drosophila_2:1628535_at:673:621; Interrogation_Position=1479; Antisense; TGCGAGCCACTACTACTTGAGGGAC
>probe:Drosophila_2:1628535_at:44:507; Interrogation_Position=1525; Antisense; GTGCCTCCTTTCATAACCAGTGGAT
>probe:Drosophila_2:1628535_at:596:539; Interrogation_Position=1669; Antisense; GGTTTTAAGGCCCATGTCGACATTC
>probe:Drosophila_2:1628535_at:332:61; Interrogation_Position=1682; Antisense; ATGTCGACATTCTGCTACGTCTGGC
>probe:Drosophila_2:1628535_at:610:579; Interrogation_Position=1703; Antisense; TGGCCAACGCCAAGAACTTTCAGTC
>probe:Drosophila_2:1628535_at:202:149; Interrogation_Position=1718; Antisense; ACTTTCAGTCCATGTTCAGCCAGAA
>probe:Drosophila_2:1628535_at:635:213; Interrogation_Position=1741; Antisense; AAGAGCGACGTGTGCGCCGTAACAT
>probe:Drosophila_2:1628535_at:346:625; Interrogation_Position=1753; Antisense; TGCGCCGTAACATCCAGTGTCAAAA
>probe:Drosophila_2:1628535_at:218:81; Interrogation_Position=1847; Antisense; AGGTGGGCCACTACTACATGCACGA
>probe:Drosophila_2:1628535_at:188:281; Interrogation_Position=1887; Antisense; CTCGATGACCCACAAGTTTCTTATT
>probe:Drosophila_2:1628535_at:487:697; Interrogation_Position=1903; Antisense; TTTCTTATTCCTGGCGAGTATCGCG
>probe:Drosophila_2:1628535_at:657:565; Interrogation_Position=1927; Antisense; GGCAAACTCACATTCTTTTACGGCA
>probe:Drosophila_2:1628535_at:549:377; Interrogation_Position=1975; Antisense; GAAGCACTGAGCCTGACGATCGACG

Paste this into a BLAST search page for me
GCCAGTGTCCTCTAAATGCGAGCCATGCGAGCCACTACTACTTGAGGGACGTGCCTCCTTTCATAACCAGTGGATGGTTTTAAGGCCCATGTCGACATTCATGTCGACATTCTGCTACGTCTGGCTGGCCAACGCCAAGAACTTTCAGTCACTTTCAGTCCATGTTCAGCCAGAAAAGAGCGACGTGTGCGCCGTAACATTGCGCCGTAACATCCAGTGTCAAAAAGGTGGGCCACTACTACATGCACGACTCGATGACCCACAAGTTTCTTATTTTTCTTATTCCTGGCGAGTATCGCGGGCAAACTCACATTCTTTTACGGCAGAAGCACTGAGCCTGACGATCGACG

Full Affymetrix probeset data:

Annotations for 1628535_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime