FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628538_at:

>probe:Drosophila_2:1628538_at:492:301; Interrogation_Position=115; Antisense; CCCTTCCAGAGGGAGGTGCGTGAAT
>probe:Drosophila_2:1628538_at:652:291; Interrogation_Position=133; Antisense; CGTGAATGGCAACGCATCGATCCCA
>probe:Drosophila_2:1628538_at:102:371; Interrogation_Position=136; Antisense; GAATGGCAACGCATCGATCCCAATA
>probe:Drosophila_2:1628538_at:635:563; Interrogation_Position=15; Antisense; GGAAGTGGCCACAACAAACAATCAC
>probe:Drosophila_2:1628538_at:631:239; Interrogation_Position=157; Antisense; AATACCGGAGCCCTCTTCAGCGGAC
>probe:Drosophila_2:1628538_at:564:415; Interrogation_Position=164; Antisense; GAGCCCTCTTCAGCGGACGCTTGGA
>probe:Drosophila_2:1628538_at:107:713; Interrogation_Position=172; Antisense; TTCAGCGGACGCTTGGAGGCAGACC
>probe:Drosophila_2:1628538_at:670:437; Interrogation_Position=187; Antisense; GAGGCAGACCGCTGGATAAACGGAC
>probe:Drosophila_2:1628538_at:410:589; Interrogation_Position=199; Antisense; TGGATAAACGGACCGCTGAACAGCT
>probe:Drosophila_2:1628538_at:524:197; Interrogation_Position=205; Antisense; AACGGACCGCTGAACAGCTACGGCA
>probe:Drosophila_2:1628538_at:191:411; Interrogation_Position=209; Antisense; GACCGCTGAACAGCTACGGCAAGGT
>probe:Drosophila_2:1628538_at:694:261; Interrogation_Position=219; Antisense; CAGCTACGGCAAGGTGAGTGTCTAA
>probe:Drosophila_2:1628538_at:720:179; Interrogation_Position=30; Antisense; AAACAATCACAGTCAGAGCCATCAT
>probe:Drosophila_2:1628538_at:463:33; Interrogation_Position=35; Antisense; ATCACAGTCAGAGCCATCATCATCA

Paste this into a BLAST search page for me
CCCTTCCAGAGGGAGGTGCGTGAATCGTGAATGGCAACGCATCGATCCCAGAATGGCAACGCATCGATCCCAATAGGAAGTGGCCACAACAAACAATCACAATACCGGAGCCCTCTTCAGCGGACGAGCCCTCTTCAGCGGACGCTTGGATTCAGCGGACGCTTGGAGGCAGACCGAGGCAGACCGCTGGATAAACGGACTGGATAAACGGACCGCTGAACAGCTAACGGACCGCTGAACAGCTACGGCAGACCGCTGAACAGCTACGGCAAGGTCAGCTACGGCAAGGTGAGTGTCTAAAAACAATCACAGTCAGAGCCATCATATCACAGTCAGAGCCATCATCATCA

Full Affymetrix probeset data:

Annotations for 1628538_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720