Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628539_at:

>probe:Drosophila_2:1628539_at:327:487; Interrogation_Position=140; Antisense; GTACCTACTTTATGCAGAATACCTG
>probe:Drosophila_2:1628539_at:580:239; Interrogation_Position=157; Antisense; AATACCTGCCAGCTTTATCAAAACA
>probe:Drosophila_2:1628539_at:482:179; Interrogation_Position=177; Antisense; AAACATTTCTAAATCCCATCCCAAG
>probe:Drosophila_2:1628539_at:145:445; Interrogation_Position=237; Antisense; GATGCATATGGAACCTGAGATCAAG
>probe:Drosophila_2:1628539_at:408:369; Interrogation_Position=265; Antisense; GAATGCTCTGTTGATGATCCCAATA
>probe:Drosophila_2:1628539_at:600:117; Interrogation_Position=369; Antisense; AGCTAGAGTGAAACAATCGGCCATT
>probe:Drosophila_2:1628539_at:312:579; Interrogation_Position=387; Antisense; GGCCATTGAATCCAATCCCGATATG
>probe:Drosophila_2:1628539_at:680:243; Interrogation_Position=483; Antisense; AATTATGGTTTCCTTCAAGAGAGAC
>probe:Drosophila_2:1628539_at:158:485; Interrogation_Position=528; Antisense; GTATGAAGCTGAGTACTCGCGACTT
>probe:Drosophila_2:1628539_at:437:489; Interrogation_Position=540; Antisense; GTACTCGCGACTTAGTAAGGTCCAC
>probe:Drosophila_2:1628539_at:169:259; Interrogation_Position=562; Antisense; CACTCTAAGTGGGTAAATTCCGAGA
>probe:Drosophila_2:1628539_at:636:463; Interrogation_Position=589; Antisense; GATTCCACCAATAACTCAAACACTC
>probe:Drosophila_2:1628539_at:552:659; Interrogation_Position=600; Antisense; TAACTCAAACACTCATCAGCCTTAG
>probe:Drosophila_2:1628539_at:448:33; Interrogation_Position=614; Antisense; ATCAGCCTTAGTCATCGCTTAGGAA

Paste this into a BLAST search page for me
GTACCTACTTTATGCAGAATACCTGAATACCTGCCAGCTTTATCAAAACAAAACATTTCTAAATCCCATCCCAAGGATGCATATGGAACCTGAGATCAAGGAATGCTCTGTTGATGATCCCAATAAGCTAGAGTGAAACAATCGGCCATTGGCCATTGAATCCAATCCCGATATGAATTATGGTTTCCTTCAAGAGAGACGTATGAAGCTGAGTACTCGCGACTTGTACTCGCGACTTAGTAAGGTCCACCACTCTAAGTGGGTAAATTCCGAGAGATTCCACCAATAACTCAAACACTCTAACTCAAACACTCATCAGCCTTAGATCAGCCTTAGTCATCGCTTAGGAA

Full Affymetrix probeset data:

Annotations for 1628539_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime