FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628541_at:

>probe:Drosophila_2:1628541_at:251:417; Interrogation_Position=1075; Antisense; GAGCGTGAAACCTCGAGGGCTGCCC
>probe:Drosophila_2:1628541_at:268:499; Interrogation_Position=1142; Antisense; GTCGTGAAACTGTACGGGCGGTCAA
>probe:Drosophila_2:1628541_at:56:621; Interrogation_Position=596; Antisense; TGCTCTGGGAGCTGATGACACGTCA
>probe:Drosophila_2:1628541_at:459:255; Interrogation_Position=648; Antisense; CAACAGCCAGTACGCCATTATGAAA
>probe:Drosophila_2:1628541_at:132:655; Interrogation_Position=710; Antisense; TAAGATCCGATTGCCCAGAGGGTAT
>probe:Drosophila_2:1628541_at:145:389; Interrogation_Position=772; Antisense; GAAAAGCGCCCCTCTATGAAGGAGA
>probe:Drosophila_2:1628541_at:623:727; Interrogation_Position=809; Antisense; TTGGCGAACAGTATGAATCCGGCAC
>probe:Drosophila_2:1628541_at:607:367; Interrogation_Position=823; Antisense; GAATCCGGCACTGACGAGGACTTTA
>probe:Drosophila_2:1628541_at:695:437; Interrogation_Position=838; Antisense; GAGGACTTTATCAAGCCTTTGGATG
>probe:Drosophila_2:1628541_at:40:27; Interrogation_Position=866; Antisense; ATACCGTGGCTGTGGTGACCTACCA
>probe:Drosophila_2:1628541_at:4:611; Interrogation_Position=881; Antisense; TGACCTACCATGTGGATTCGTCCGG
>probe:Drosophila_2:1628541_at:384:717; Interrogation_Position=897; Antisense; TTCGTCCGGCAGCAGGATAATGCGT
>probe:Drosophila_2:1628541_at:675:51; Interrogation_Position=916; Antisense; ATGCGTGTTGATTTCTGGCGACATC
>probe:Drosophila_2:1628541_at:700:449; Interrogation_Position=951; Antisense; GATCCGCATGACTTTTCCGATAGTG

Paste this into a BLAST search page for me
GAGCGTGAAACCTCGAGGGCTGCCCGTCGTGAAACTGTACGGGCGGTCAATGCTCTGGGAGCTGATGACACGTCACAACAGCCAGTACGCCATTATGAAATAAGATCCGATTGCCCAGAGGGTATGAAAAGCGCCCCTCTATGAAGGAGATTGGCGAACAGTATGAATCCGGCACGAATCCGGCACTGACGAGGACTTTAGAGGACTTTATCAAGCCTTTGGATGATACCGTGGCTGTGGTGACCTACCATGACCTACCATGTGGATTCGTCCGGTTCGTCCGGCAGCAGGATAATGCGTATGCGTGTTGATTTCTGGCGACATCGATCCGCATGACTTTTCCGATAGTG

Full Affymetrix probeset data:

Annotations for 1628541_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720