FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628544_at:

>probe:Drosophila_2:1628544_at:552:323; Interrogation_Position=135; Antisense; GCGCGATTTGATACAGCATATAGAT
>probe:Drosophila_2:1628544_at:465:367; Interrogation_Position=164; Antisense; GAATCGTCAATCTGAACAATCGGAG
>probe:Drosophila_2:1628544_at:85:41; Interrogation_Position=182; Antisense; ATCGGAGTTACGTTAACGGCGAGAT
>probe:Drosophila_2:1628544_at:79:657; Interrogation_Position=236; Antisense; TAATGCACACAACCATGGATTTTTG
>probe:Drosophila_2:1628544_at:687:251; Interrogation_Position=27; Antisense; CACGTCTACTTTGTTTTGGCTACTG
>probe:Drosophila_2:1628544_at:510:591; Interrogation_Position=297; Antisense; TGGTCGCTTGGATGCATGTCAGTTC
>probe:Drosophila_2:1628544_at:8:497; Interrogation_Position=314; Antisense; GTCAGTTCCTGAAAACATCTCACCG
>probe:Drosophila_2:1628544_at:225:1; Interrogation_Position=398; Antisense; GTTGTCCTCTAAGAACGAACTTCAA
>probe:Drosophila_2:1628544_at:616:689; Interrogation_Position=41; Antisense; TTTGGCTACTGTGGTTTACCAACCA
>probe:Drosophila_2:1628544_at:258:57; Interrogation_Position=449; Antisense; ATGAGAAGGATCTACCGCCGTTTGT
>probe:Drosophila_2:1628544_at:679:721; Interrogation_Position=478; Antisense; TTGGGTACTTTTCGGACTGTCACCG
>probe:Drosophila_2:1628544_at:97:557; Interrogation_Position=491; Antisense; GGACTGTCACCGAATATTTTACACA
>probe:Drosophila_2:1628544_at:327:257; Interrogation_Position=512; Antisense; CACAAGACCGATTGGCACTGCGAAT
>probe:Drosophila_2:1628544_at:677:471; Interrogation_Position=54; Antisense; GTTTACCAACCACATTTGCCTAAAG

Paste this into a BLAST search page for me
GCGCGATTTGATACAGCATATAGATGAATCGTCAATCTGAACAATCGGAGATCGGAGTTACGTTAACGGCGAGATTAATGCACACAACCATGGATTTTTGCACGTCTACTTTGTTTTGGCTACTGTGGTCGCTTGGATGCATGTCAGTTCGTCAGTTCCTGAAAACATCTCACCGGTTGTCCTCTAAGAACGAACTTCAATTTGGCTACTGTGGTTTACCAACCAATGAGAAGGATCTACCGCCGTTTGTTTGGGTACTTTTCGGACTGTCACCGGGACTGTCACCGAATATTTTACACACACAAGACCGATTGGCACTGCGAATGTTTACCAACCACATTTGCCTAAAG

Full Affymetrix probeset data:

Annotations for 1628544_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720