Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628545_at:

>probe:Drosophila_2:1628545_at:192:625; Interrogation_Position=1266; Antisense; TGCCAAGTACAACATGCCCGAGATA
>probe:Drosophila_2:1628545_at:585:303; Interrogation_Position=1283; Antisense; CCGAGATACTTTCGCCCATTATGGA
>probe:Drosophila_2:1628545_at:415:235; Interrogation_Position=1342; Antisense; AATCGCTTCGATCAGGATTACGCGT
>probe:Drosophila_2:1628545_at:693:141; Interrogation_Position=1371; Antisense; ACTGTTCTCGGATCGAATGGCTCTA
>probe:Drosophila_2:1628545_at:47:69; Interrogation_Position=1387; Antisense; ATGGCTCTATACGACTATGCCCAGC
>probe:Drosophila_2:1628545_at:133:179; Interrogation_Position=1429; Antisense; AAACTGCTGAGAATTCCCATCGACT
>probe:Drosophila_2:1628545_at:237:541; Interrogation_Position=1493; Antisense; GGTTCCTCAAGCACCATTTGGGACG
>probe:Drosophila_2:1628545_at:172:595; Interrogation_Position=1528; Antisense; TGGGCCTTCGAGAGCGGTCTTACAA
>probe:Drosophila_2:1628545_at:321:439; Interrogation_Position=1579; Antisense; GAGGCAGTTCGCGTGGGCTATCTAA
>probe:Drosophila_2:1628545_at:324:577; Interrogation_Position=1629; Antisense; GGCCCAGCCGCTGAATGTGGATTAT
>probe:Drosophila_2:1628545_at:701:589; Interrogation_Position=1646; Antisense; TGGATTATTTCGTCATGCCGGCAAT
>probe:Drosophila_2:1628545_at:304:47; Interrogation_Position=1690; Antisense; ATCCTGGCCCTTTTGAGTTTTGTCA
>probe:Drosophila_2:1628545_at:466:647; Interrogation_Position=1712; Antisense; TCATCGAGATGACGGCCTGGCGCAT
>probe:Drosophila_2:1628545_at:541:405; Interrogation_Position=1764; Antisense; GACGATGACGAGTACCGGTTGTTCA

Paste this into a BLAST search page for me
TGCCAAGTACAACATGCCCGAGATACCGAGATACTTTCGCCCATTATGGAAATCGCTTCGATCAGGATTACGCGTACTGTTCTCGGATCGAATGGCTCTAATGGCTCTATACGACTATGCCCAGCAAACTGCTGAGAATTCCCATCGACTGGTTCCTCAAGCACCATTTGGGACGTGGGCCTTCGAGAGCGGTCTTACAAGAGGCAGTTCGCGTGGGCTATCTAAGGCCCAGCCGCTGAATGTGGATTATTGGATTATTTCGTCATGCCGGCAATATCCTGGCCCTTTTGAGTTTTGTCATCATCGAGATGACGGCCTGGCGCATGACGATGACGAGTACCGGTTGTTCA

Full Affymetrix probeset data:

Annotations for 1628545_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime