FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628547_at:

>probe:Drosophila_2:1628547_at:282:99; Interrogation_Position=1010; Antisense; AGATGCAGGCCTACATGACGTATCC
>probe:Drosophila_2:1628547_at:81:611; Interrogation_Position=1025; Antisense; TGACGTATCCCTCATGGTTTGCGGC
>probe:Drosophila_2:1628547_at:72:647; Interrogation_Position=1064; Antisense; TCTTCGCCTCTATCATTGGCATTAT
>probe:Drosophila_2:1628547_at:647:569; Interrogation_Position=1081; Antisense; GGCATTATGGCCAAGTTCTCCTTTG
>probe:Drosophila_2:1628547_at:641:729; Interrogation_Position=1103; Antisense; TTGGCCGCCAGCTGCTGCTTAAGTA
>probe:Drosophila_2:1628547_at:212:67; Interrogation_Position=1183; Antisense; ATGGAGCGCTCCTTCTTCAGAATGA
>probe:Drosophila_2:1628547_at:308:369; Interrogation_Position=1202; Antisense; GAATGACCATGAAGGCCACAGGCTG
>probe:Drosophila_2:1628547_at:472:573; Interrogation_Position=1222; Antisense; GGCTGGCCCAAGTCCGAAAAACTAG
>probe:Drosophila_2:1628547_at:678:387; Interrogation_Position=1237; Antisense; GAAAAACTAGCCGAGACCACCGATC
>probe:Drosophila_2:1628547_at:280:275; Interrogation_Position=1320; Antisense; CTATGGATCCACTTGCGTTGCACTG
>probe:Drosophila_2:1628547_at:684:575; Interrogation_Position=1353; Antisense; GGCGAAGACCATCCTCAACGAAAGC
>probe:Drosophila_2:1628547_at:289:521; Interrogation_Position=1427; Antisense; GTGGCACCAGTCTCATCAGCGAGCT
>probe:Drosophila_2:1628547_at:305:355; Interrogation_Position=1458; Antisense; GCACGAGCACGGCATTAAGTTTGAA
>probe:Drosophila_2:1628547_at:240:109; Interrogation_Position=995; Antisense; AGAAGCGACCCGTTCAGATGCAGGC

Paste this into a BLAST search page for me
AGATGCAGGCCTACATGACGTATCCTGACGTATCCCTCATGGTTTGCGGCTCTTCGCCTCTATCATTGGCATTATGGCATTATGGCCAAGTTCTCCTTTGTTGGCCGCCAGCTGCTGCTTAAGTAATGGAGCGCTCCTTCTTCAGAATGAGAATGACCATGAAGGCCACAGGCTGGGCTGGCCCAAGTCCGAAAAACTAGGAAAAACTAGCCGAGACCACCGATCCTATGGATCCACTTGCGTTGCACTGGGCGAAGACCATCCTCAACGAAAGCGTGGCACCAGTCTCATCAGCGAGCTGCACGAGCACGGCATTAAGTTTGAAAGAAGCGACCCGTTCAGATGCAGGC

Full Affymetrix probeset data:

Annotations for 1628547_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720