FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628551_at:

>probe:Drosophila_2:1628551_at:282:217; Interrogation_Position=1084; Antisense; AAGTTGCCCTATTGCGAGGCTATCA
>probe:Drosophila_2:1628551_at:590:437; Interrogation_Position=1099; Antisense; GAGGCTATCACCTTGGAGGCGGTCA
>probe:Drosophila_2:1628551_at:93:331; Interrogation_Position=1117; Antisense; GCGGTCAGAATGTTCATGCTCCACA
>probe:Drosophila_2:1628551_at:506:499; Interrogation_Position=1165; Antisense; GTCTGCGATACTCGATTGTCGGGAT
>probe:Drosophila_2:1628551_at:286:397; Interrogation_Position=1204; Antisense; GACACCATGGTGATTGCCTGTTTCA
>probe:Drosophila_2:1628551_at:86:565; Interrogation_Position=1231; Antisense; GGAATGCTGATCAACCCAGTCGACT
>probe:Drosophila_2:1628551_at:341:277; Interrogation_Position=1254; Antisense; CTTTCCCGATCCAGAGTCATTCAAT
>probe:Drosophila_2:1628551_at:582:535; Interrogation_Position=1281; Antisense; GGATAGATACCTCTTCGATGGCCAT
>probe:Drosophila_2:1628551_at:186:441; Interrogation_Position=1297; Antisense; GATGGCCATCTGAAACTACCTGAGG
>probe:Drosophila_2:1628551_at:312:691; Interrogation_Position=1333; Antisense; TTTGGGTTCGGACGTCATCGCTGCA
>probe:Drosophila_2:1628551_at:235:367; Interrogation_Position=1380; Antisense; GAATCTGTTTATGTTCACGACCACA
>probe:Drosophila_2:1628551_at:12:25; Interrogation_Position=929; Antisense; ATATGTTCTTGGCTGGGTCCGAGAC
>probe:Drosophila_2:1628551_at:452:211; Interrogation_Position=961; Antisense; AAGAGCCTGGGCTTCTGTTTCATGC
>probe:Drosophila_2:1628551_at:149:55; Interrogation_Position=982; Antisense; ATGCACTTGGTGCTGCAGCCTGAAA

Paste this into a BLAST search page for me
AAGTTGCCCTATTGCGAGGCTATCAGAGGCTATCACCTTGGAGGCGGTCAGCGGTCAGAATGTTCATGCTCCACAGTCTGCGATACTCGATTGTCGGGATGACACCATGGTGATTGCCTGTTTCAGGAATGCTGATCAACCCAGTCGACTCTTTCCCGATCCAGAGTCATTCAATGGATAGATACCTCTTCGATGGCCATGATGGCCATCTGAAACTACCTGAGGTTTGGGTTCGGACGTCATCGCTGCAGAATCTGTTTATGTTCACGACCACAATATGTTCTTGGCTGGGTCCGAGACAAGAGCCTGGGCTTCTGTTTCATGCATGCACTTGGTGCTGCAGCCTGAAA

Full Affymetrix probeset data:

Annotations for 1628551_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720