FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628552_at:

>probe:Drosophila_2:1628552_at:460:193; Interrogation_Position=2069; Antisense; AACTGCTGCAGCTTTCTCCGGAGCT
>probe:Drosophila_2:1628552_at:288:273; Interrogation_Position=2084; Antisense; CTCCGGAGCTACGTTTGGACTACGA
>probe:Drosophila_2:1628552_at:36:727; Interrogation_Position=2098; Antisense; TTGGACTACGACCAATTGCAGGCTC
>probe:Drosophila_2:1628552_at:704:69; Interrogation_Position=2117; Antisense; AGGCTCATCCATTCTTCAAAGGCAT
>probe:Drosophila_2:1628552_at:650:169; Interrogation_Position=2134; Antisense; AAAGGCATCGATTGGCAGGCGGTTT
>probe:Drosophila_2:1628552_at:190:419; Interrogation_Position=2161; Antisense; GAGCAGGGAACTGAGTCCATGTGAA
>probe:Drosophila_2:1628552_at:430:19; Interrogation_Position=2196; Antisense; ATTTGCTTTGCTATTGAGTCCGTAA
>probe:Drosophila_2:1628552_at:520:689; Interrogation_Position=2223; Antisense; TATTTTCTTATTTCGTACTGTACCT
>probe:Drosophila_2:1628552_at:142:279; Interrogation_Position=2236; Antisense; CGTACTGTACCTGAAATCCCATTTG
>probe:Drosophila_2:1628552_at:209:235; Interrogation_Position=2250; Antisense; AATCCCATTTGTGATTCCTTGCTCA
>probe:Drosophila_2:1628552_at:598:719; Interrogation_Position=2264; Antisense; TTCCTTGCTCAGTTCTGATTGGCAT
>probe:Drosophila_2:1628552_at:8:211; Interrogation_Position=2307; Antisense; AAGAATCTGAAGTCGCTCCATAGCG
>probe:Drosophila_2:1628552_at:143:53; Interrogation_Position=2427; Antisense; ATGAGTCTTTTATGTTGTTCCTTTT
>probe:Drosophila_2:1628552_at:445:19; Interrogation_Position=2515; Antisense; ATTTGCAAAGTGTCCTAGTTTATGT

Paste this into a BLAST search page for me
AACTGCTGCAGCTTTCTCCGGAGCTCTCCGGAGCTACGTTTGGACTACGATTGGACTACGACCAATTGCAGGCTCAGGCTCATCCATTCTTCAAAGGCATAAAGGCATCGATTGGCAGGCGGTTTGAGCAGGGAACTGAGTCCATGTGAAATTTGCTTTGCTATTGAGTCCGTAATATTTTCTTATTTCGTACTGTACCTCGTACTGTACCTGAAATCCCATTTGAATCCCATTTGTGATTCCTTGCTCATTCCTTGCTCAGTTCTGATTGGCATAAGAATCTGAAGTCGCTCCATAGCGATGAGTCTTTTATGTTGTTCCTTTTATTTGCAAAGTGTCCTAGTTTATGT

Full Affymetrix probeset data:

Annotations for 1628552_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720