FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628555_at:

>probe:Drosophila_2:1628555_at:114:321; Interrogation_Position=1026; Antisense; GCCGCCCACTTCATTAGACTTTAAT
>probe:Drosophila_2:1628555_at:159:373; Interrogation_Position=565; Antisense; GAAGGGCAAGAAACACCGTCTCCGC
>probe:Drosophila_2:1628555_at:14:623; Interrogation_Position=621; Antisense; TGCTGAAGGCCATCACAGTGATCCC
>probe:Drosophila_2:1628555_at:107:153; Interrogation_Position=635; Antisense; ACAGTGATCCCCATGGCCATTGGCA
>probe:Drosophila_2:1628555_at:402:69; Interrogation_Position=647; Antisense; ATGGCCATTGGCATCCTGAAGATCA
>probe:Drosophila_2:1628555_at:157:375; Interrogation_Position=664; Antisense; GAAGATCAAGGCCTTCAACGCCCTG
>probe:Drosophila_2:1628555_at:130:647; Interrogation_Position=708; Antisense; TCATTGTCTCGGTTGGTTTGGCCAT
>probe:Drosophila_2:1628555_at:52:581; Interrogation_Position=726; Antisense; TGGCCATTTTCCAATTGTGCAAAAA
>probe:Drosophila_2:1628555_at:295:91; Interrogation_Position=750; Antisense; AGATTGCTCATGATCACCATCACAC
>probe:Drosophila_2:1628555_at:92:71; Interrogation_Position=879; Antisense; AGGCCTACGCTTAGACCACAAGGAT
>probe:Drosophila_2:1628555_at:235:225; Interrogation_Position=898; Antisense; AAGGATGAACCCCTGAGAGCCCAGA
>probe:Drosophila_2:1628555_at:513:259; Interrogation_Position=938; Antisense; CAGCTAGTGGGCTCAAAAGCACAGA
>probe:Drosophila_2:1628555_at:160:365; Interrogation_Position=982; Antisense; GAATATTCGGTGACTTTGAGCCACT
>probe:Drosophila_2:1628555_at:38:723; Interrogation_Position=997; Antisense; TTGAGCCACTGTTTCACACTTCCAG

Paste this into a BLAST search page for me
GCCGCCCACTTCATTAGACTTTAATGAAGGGCAAGAAACACCGTCTCCGCTGCTGAAGGCCATCACAGTGATCCCACAGTGATCCCCATGGCCATTGGCAATGGCCATTGGCATCCTGAAGATCAGAAGATCAAGGCCTTCAACGCCCTGTCATTGTCTCGGTTGGTTTGGCCATTGGCCATTTTCCAATTGTGCAAAAAAGATTGCTCATGATCACCATCACACAGGCCTACGCTTAGACCACAAGGATAAGGATGAACCCCTGAGAGCCCAGACAGCTAGTGGGCTCAAAAGCACAGAGAATATTCGGTGACTTTGAGCCACTTTGAGCCACTGTTTCACACTTCCAG

Full Affymetrix probeset data:

Annotations for 1628555_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720