FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628557_at:

>probe:Drosophila_2:1628557_at:380:601; Interrogation_Position=1013; Antisense; TGTTAAGACCACTCTTCCGGCTCTA
>probe:Drosophila_2:1628557_at:8:709; Interrogation_Position=1048; Antisense; TTACGGGCACCAAGGGCACTGTCAT
>probe:Drosophila_2:1628557_at:445:303; Interrogation_Position=1075; Antisense; CCGCCTTTGGATCGCTGCCGAAGAA
>probe:Drosophila_2:1628557_at:627:107; Interrogation_Position=1096; Antisense; AGAAGCCAGCCGTTTAGATTTTAAT
>probe:Drosophila_2:1628557_at:681:707; Interrogation_Position=1141; Antisense; TTAAACATTCTCATCCCAAGGCTTT
>probe:Drosophila_2:1628557_at:231:203; Interrogation_Position=636; Antisense; AAGCCGTCCGCCGAATTAGTGGCCA
>probe:Drosophila_2:1628557_at:634:71; Interrogation_Position=730; Antisense; AGGAATTTCGCAATCCCAGCATATA
>probe:Drosophila_2:1628557_at:2:33; Interrogation_Position=765; Antisense; ATAAGCTTTTGCGACATCAACGAGT
>probe:Drosophila_2:1628557_at:30:253; Interrogation_Position=782; Antisense; CAACGAGTTCGGTACCAACTATCCG
>probe:Drosophila_2:1628557_at:107:427; Interrogation_Position=810; Antisense; GAGATCTATGATCCTTTGCAGTGGG
>probe:Drosophila_2:1628557_at:186:431; Interrogation_Position=840; Antisense; GAGTCCTATTACGAGTCCTTGGCGG
>probe:Drosophila_2:1628557_at:75:629; Interrogation_Position=855; Antisense; TCCTTGGCGGCGGTCCAGAAAACGG
>probe:Drosophila_2:1628557_at:332:219; Interrogation_Position=981; Antisense; AAGTGGGATCAACCGGCACCTTCGT
>probe:Drosophila_2:1628557_at:699:353; Interrogation_Position=996; Antisense; GCACCTTCGTCAACCGTTGTTAAGA

Paste this into a BLAST search page for me
TGTTAAGACCACTCTTCCGGCTCTATTACGGGCACCAAGGGCACTGTCATCCGCCTTTGGATCGCTGCCGAAGAAAGAAGCCAGCCGTTTAGATTTTAATTTAAACATTCTCATCCCAAGGCTTTAAGCCGTCCGCCGAATTAGTGGCCAAGGAATTTCGCAATCCCAGCATATAATAAGCTTTTGCGACATCAACGAGTCAACGAGTTCGGTACCAACTATCCGGAGATCTATGATCCTTTGCAGTGGGGAGTCCTATTACGAGTCCTTGGCGGTCCTTGGCGGCGGTCCAGAAAACGGAAGTGGGATCAACCGGCACCTTCGTGCACCTTCGTCAACCGTTGTTAAGA

Full Affymetrix probeset data:

Annotations for 1628557_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720