FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628558_at:

>probe:Drosophila_2:1628558_at:349:199; Interrogation_Position=677; Antisense; AACGAGATGCCCAGCTGGTCAAGGA
>probe:Drosophila_2:1628558_at:293:589; Interrogation_Position=692; Antisense; TGGTCAAGGATCTGGGCTTCGAGTT
>probe:Drosophila_2:1628558_at:463:373; Interrogation_Position=717; Antisense; GAAGTATGCCATCAACACACACATG
>probe:Drosophila_2:1628558_at:555:257; Interrogation_Position=732; Antisense; CACACACATGCATGCGGATCACATA
>probe:Drosophila_2:1628558_at:536:91; Interrogation_Position=779; Antisense; AGTTAACTGGGTGTCAATCTGTGAT
>probe:Drosophila_2:1628558_at:108:237; Interrogation_Position=794; Antisense; AATCTGTGATTGCTGCCGCCAGTGG
>probe:Drosophila_2:1628558_at:432:413; Interrogation_Position=818; Antisense; GAGCCAAGGCGGATCGTCACCTGAA
>probe:Drosophila_2:1628558_at:34:547; Interrogation_Position=849; Antisense; GGATCGCATAGATTTCGGCACCCAT
>probe:Drosophila_2:1628558_at:543:567; Interrogation_Position=865; Antisense; GGCACCCATGTGATTGATGCTCTGG
>probe:Drosophila_2:1628558_at:545:631; Interrogation_Position=894; Antisense; TCCGGGACACACAAATGGCTGCATG
>probe:Drosophila_2:1628558_at:627:67; Interrogation_Position=908; Antisense; ATGGCTGCATGACCTATGTGATCAA
>probe:Drosophila_2:1628558_at:289:33; Interrogation_Position=935; Antisense; ATCAGGGTTGTGTCTTTACCGGAGA
>probe:Drosophila_2:1628558_at:201:457; Interrogation_Position=958; Antisense; GATACTCTCCTGATACGAGGCTGTG
>probe:Drosophila_2:1628558_at:366:541; Interrogation_Position=982; Antisense; GGACGCACCGATTTCCAGGAAGGCT

Paste this into a BLAST search page for me
AACGAGATGCCCAGCTGGTCAAGGATGGTCAAGGATCTGGGCTTCGAGTTGAAGTATGCCATCAACACACACATGCACACACATGCATGCGGATCACATAAGTTAACTGGGTGTCAATCTGTGATAATCTGTGATTGCTGCCGCCAGTGGGAGCCAAGGCGGATCGTCACCTGAAGGATCGCATAGATTTCGGCACCCATGGCACCCATGTGATTGATGCTCTGGTCCGGGACACACAAATGGCTGCATGATGGCTGCATGACCTATGTGATCAAATCAGGGTTGTGTCTTTACCGGAGAGATACTCTCCTGATACGAGGCTGTGGGACGCACCGATTTCCAGGAAGGCT

Full Affymetrix probeset data:

Annotations for 1628558_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720