FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628560_at:

>probe:Drosophila_2:1628560_at:41:173; Interrogation_Position=109; Antisense; AAAATGTCCCGCAAAGAGGCCCTGT
>probe:Drosophila_2:1628560_at:236:31; Interrogation_Position=142; Antisense; ATCAATCAGATACACGGACGCCCCG
>probe:Drosophila_2:1628560_at:270:321; Interrogation_Position=161; Antisense; GCCCCGTCGCCGTAAAGCTGAACAA
>probe:Drosophila_2:1628560_at:331:185; Interrogation_Position=181; Antisense; AACAACGGCGTTGACTATCGAGGTG
>probe:Drosophila_2:1628560_at:708:147; Interrogation_Position=194; Antisense; ACTATCGAGGTGTGCTGGCCTGTCT
>probe:Drosophila_2:1628560_at:343:581; Interrogation_Position=209; Antisense; TGGCCTGTCTGGATGGCTACATGAA
>probe:Drosophila_2:1628560_at:149:341; Interrogation_Position=224; Antisense; GCTACATGAACATCTGCCTGGAGCA
>probe:Drosophila_2:1628560_at:118:567; Interrogation_Position=307; Antisense; GGCAACAATGTCCTCTACATTTCCA
>probe:Drosophila_2:1628560_at:590:19; Interrogation_Position=325; Antisense; ATTTCCACGCAGAAGCGGAGGGTCT
>probe:Drosophila_2:1628560_at:59:77; Interrogation_Position=356; Antisense; AGGAGGGTCTCAACTGGCATGGCAC
>probe:Drosophila_2:1628560_at:80:349; Interrogation_Position=372; Antisense; GCATGGCACCATGAAGTTCGTAGTT
>probe:Drosophila_2:1628560_at:544:107; Interrogation_Position=399; Antisense; AGAACTCTGATTCCTCTGTTTCCTT
>probe:Drosophila_2:1628560_at:150:599; Interrogation_Position=415; Antisense; TGTTTCCTTCAGAGGGAACCTGCGA
>probe:Drosophila_2:1628560_at:333:563; Interrogation_Position=429; Antisense; GGAACCTGCGACAACACAAGTGTTT

Paste this into a BLAST search page for me
AAAATGTCCCGCAAAGAGGCCCTGTATCAATCAGATACACGGACGCCCCGGCCCCGTCGCCGTAAAGCTGAACAAAACAACGGCGTTGACTATCGAGGTGACTATCGAGGTGTGCTGGCCTGTCTTGGCCTGTCTGGATGGCTACATGAAGCTACATGAACATCTGCCTGGAGCAGGCAACAATGTCCTCTACATTTCCAATTTCCACGCAGAAGCGGAGGGTCTAGGAGGGTCTCAACTGGCATGGCACGCATGGCACCATGAAGTTCGTAGTTAGAACTCTGATTCCTCTGTTTCCTTTGTTTCCTTCAGAGGGAACCTGCGAGGAACCTGCGACAACACAAGTGTTT

Full Affymetrix probeset data:

Annotations for 1628560_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720