FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628561_at:

>probe:Drosophila_2:1628561_at:107:563; Interrogation_Position=124; Antisense; GGAAGCTACAAGGTACGCCAAGGTA
>probe:Drosophila_2:1628561_at:507:51; Interrogation_Position=13; Antisense; ATGCGGATCAATCTCATCTACTTCA
>probe:Drosophila_2:1628561_at:728:299; Interrogation_Position=139; Antisense; CGCCAAGGTAGATATTTTCCAGATA
>probe:Drosophila_2:1628561_at:221:459; Interrogation_Position=160; Antisense; GATATTTTCCGATCACACAAGTACT
>probe:Drosophila_2:1628561_at:227:727; Interrogation_Position=211; Antisense; TTGTTCATACCCAGCTATGGACGCT
>probe:Drosophila_2:1628561_at:286:39; Interrogation_Position=28; Antisense; ATCTACTTCACGCTGCTTTGGGCAT
>probe:Drosophila_2:1628561_at:317:445; Interrogation_Position=281; Antisense; GATGCTCAGAATTTACCTACAGTGG
>probe:Drosophila_2:1628561_at:539:455; Interrogation_Position=337; Antisense; GATAGCCAATGTCGAAACACTTGCT
>probe:Drosophila_2:1628561_at:437:187; Interrogation_Position=352; Antisense; AACACTTGCTATGTGGTTCCAGCGA
>probe:Drosophila_2:1628561_at:527:541; Interrogation_Position=366; Antisense; GGTTCCAGCGAGGAAAACCGTCTCA
>probe:Drosophila_2:1628561_at:323:201; Interrogation_Position=381; Antisense; AACCGTCTCAGAACCGGACTATTAT
>probe:Drosophila_2:1628561_at:245:15; Interrogation_Position=401; Antisense; ATTATGCCGATGACGGTGTCACAGA
>probe:Drosophila_2:1628561_at:490:569; Interrogation_Position=48; Antisense; GGCATTCTTCTTCTCAACCGAAGTA
>probe:Drosophila_2:1628561_at:587:295; Interrogation_Position=91; Antisense; CGAGAGTCCGATATACGACGTATAA

Paste this into a BLAST search page for me
GGAAGCTACAAGGTACGCCAAGGTAATGCGGATCAATCTCATCTACTTCACGCCAAGGTAGATATTTTCCAGATAGATATTTTCCGATCACACAAGTACTTTGTTCATACCCAGCTATGGACGCTATCTACTTCACGCTGCTTTGGGCATGATGCTCAGAATTTACCTACAGTGGGATAGCCAATGTCGAAACACTTGCTAACACTTGCTATGTGGTTCCAGCGAGGTTCCAGCGAGGAAAACCGTCTCAAACCGTCTCAGAACCGGACTATTATATTATGCCGATGACGGTGTCACAGAGGCATTCTTCTTCTCAACCGAAGTACGAGAGTCCGATATACGACGTATAA

Full Affymetrix probeset data:

Annotations for 1628561_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720