Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628563_at:

>probe:Drosophila_2:1628563_at:467:319; Interrogation_Position=1533; Antisense; GCCGCCGTCGAGGTGTTTAATGGAT
>probe:Drosophila_2:1628563_at:375:367; Interrogation_Position=1585; Antisense; GAATCGGCGGCAATCTGGTATCGGT
>probe:Drosophila_2:1628563_at:346:215; Interrogation_Position=1620; Antisense; AAGATATCCACAATGCTGCACCAGA
>probe:Drosophila_2:1628563_at:570:353; Interrogation_Position=1637; Antisense; GCACCAGAGCTCAATTATCGGGATT
>probe:Drosophila_2:1628563_at:116:135; Interrogation_Position=1674; Antisense; ACGCAGATCTTCGAGTGGCCTTGGC
>probe:Drosophila_2:1628563_at:134:551; Interrogation_Position=1713; Antisense; GGAGTTCCCTATGCGAAGACAGCGA
>probe:Drosophila_2:1628563_at:235:457; Interrogation_Position=1739; Antisense; GATACTTATTGCCATGTCCATACCC
>probe:Drosophila_2:1628563_at:530:27; Interrogation_Position=1758; Antisense; ATACCCGGCAATGTTCTGTTCATCT
>probe:Drosophila_2:1628563_at:476:285; Interrogation_Position=1773; Antisense; CTGTTCATCTTTGCTGCTGACTATA
>probe:Drosophila_2:1628563_at:293:685; Interrogation_Position=1796; Antisense; TATAAACTATAGCACCTCGACGGTC
>probe:Drosophila_2:1628563_at:132:515; Interrogation_Position=1827; Antisense; GTGTTTGTGCTTTCCTATTTGACCG
>probe:Drosophila_2:1628563_at:357:19; Interrogation_Position=1843; Antisense; ATTTGACCGCCAGTTTGGTTCAGGT
>probe:Drosophila_2:1628563_at:227:605; Interrogation_Position=1867; Antisense; TGATGCTGCTGCTGTATATTGCCCA
>probe:Drosophila_2:1628563_at:647:449; Interrogation_Position=1922; Antisense; GATCGATCCGGATAACTCGGCCATA

Paste this into a BLAST search page for me
GCCGCCGTCGAGGTGTTTAATGGATGAATCGGCGGCAATCTGGTATCGGTAAGATATCCACAATGCTGCACCAGAGCACCAGAGCTCAATTATCGGGATTACGCAGATCTTCGAGTGGCCTTGGCGGAGTTCCCTATGCGAAGACAGCGAGATACTTATTGCCATGTCCATACCCATACCCGGCAATGTTCTGTTCATCTCTGTTCATCTTTGCTGCTGACTATATATAAACTATAGCACCTCGACGGTCGTGTTTGTGCTTTCCTATTTGACCGATTTGACCGCCAGTTTGGTTCAGGTTGATGCTGCTGCTGTATATTGCCCAGATCGATCCGGATAACTCGGCCATA

Full Affymetrix probeset data:

Annotations for 1628563_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime