FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628564_at:

>probe:Drosophila_2:1628564_at:146:179; Interrogation_Position=1049; Antisense; AAACTATTCACATCGGAGGTCCACC
>probe:Drosophila_2:1628564_at:397:435; Interrogation_Position=1064; Antisense; GAGGTCCACCTGAGCGAGGTCTTCA
>probe:Drosophila_2:1628564_at:576:419; Interrogation_Position=1122; Antisense; GAGCAGTGGTCCAGAGTGGTCTCCT
>probe:Drosophila_2:1628564_at:478:589; Interrogation_Position=1221; Antisense; TGGTCATCAATCACCCGTTCTTTTA
>probe:Drosophila_2:1628564_at:581:565; Interrogation_Position=1253; Antisense; GGCAATGGCAAAACTCTGCTGCTGT
>probe:Drosophila_2:1628564_at:545:579; Interrogation_Position=1280; Antisense; GGCCACATCGTCGACATCTGAGTCT
>probe:Drosophila_2:1628564_at:473:39; Interrogation_Position=1295; Antisense; ATCTGAGTCTTTCTAGGCATACCTA
>probe:Drosophila_2:1628564_at:343:569; Interrogation_Position=1310; Antisense; GGCATACCTAATTCTCGATTCCAAT
>probe:Drosophila_2:1628564_at:569:231; Interrogation_Position=1332; Antisense; AATGCTAGTTCAAGCCGGGCGGGCT
>probe:Drosophila_2:1628564_at:342:27; Interrogation_Position=1391; Antisense; ATAAACAGAATCACCCGTGGCCAGC
>probe:Drosophila_2:1628564_at:509:351; Interrogation_Position=854; Antisense; GCAGACCTCCGAATGCTCATTGTAT
>probe:Drosophila_2:1628564_at:718:5; Interrogation_Position=872; Antisense; ATTGTATTTCCCAATCGGCCTGATG
>probe:Drosophila_2:1628564_at:309:69; Interrogation_Position=894; Antisense; ATGGCCTGGCCCAACTTGAGAGGAA
>probe:Drosophila_2:1628564_at:444:655; Interrogation_Position=945; Antisense; TAAGGTCCCAGCTCGAGGAGCGCAA

Paste this into a BLAST search page for me
AAACTATTCACATCGGAGGTCCACCGAGGTCCACCTGAGCGAGGTCTTCAGAGCAGTGGTCCAGAGTGGTCTCCTTGGTCATCAATCACCCGTTCTTTTAGGCAATGGCAAAACTCTGCTGCTGTGGCCACATCGTCGACATCTGAGTCTATCTGAGTCTTTCTAGGCATACCTAGGCATACCTAATTCTCGATTCCAATAATGCTAGTTCAAGCCGGGCGGGCTATAAACAGAATCACCCGTGGCCAGCGCAGACCTCCGAATGCTCATTGTATATTGTATTTCCCAATCGGCCTGATGATGGCCTGGCCCAACTTGAGAGGAATAAGGTCCCAGCTCGAGGAGCGCAA

Full Affymetrix probeset data:

Annotations for 1628564_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720