Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628565_at:

>probe:Drosophila_2:1628565_at:219:449; Interrogation_Position=266; Antisense; GATCCTTTACGAGGTGTTCCTGCAA
>probe:Drosophila_2:1628565_at:59:199; Interrogation_Position=289; Antisense; AAGCTGGCCCCATCGAAGGAGTGCG
>probe:Drosophila_2:1628565_at:602:455; Interrogation_Position=314; Antisense; GATACCGACCGATAACAATGGGCGT
>probe:Drosophila_2:1628565_at:404:655; Interrogation_Position=347; Antisense; TTTCGGGTTTGTCACATACCAACGC
>probe:Drosophila_2:1628565_at:179:279; Interrogation_Position=393; Antisense; CTAGACTTGTACCAGGGCCTTGAAC
>probe:Drosophila_2:1628565_at:361:393; Interrogation_Position=428; Antisense; GAAAGTCACCATCAAGCAGCAGGGC
>probe:Drosophila_2:1628565_at:323:219; Interrogation_Position=479; Antisense; AAGTCGTCTGCGCAATCAGTTCATG
>probe:Drosophila_2:1628565_at:249:473; Interrogation_Position=497; Antisense; GTTCATGATGGAGGCTCTACCGCAG
>probe:Drosophila_2:1628565_at:391:495; Interrogation_Position=535; Antisense; GTCACGCCCGACACAGTTTGCATAA
>probe:Drosophila_2:1628565_at:31:287; Interrogation_Position=568; Antisense; CGTACGATCGCAATCCTTTTGGACA
>probe:Drosophila_2:1628565_at:110:701; Interrogation_Position=584; Antisense; TTTTGGACACAACGCCGATCAACGG
>probe:Drosophila_2:1628565_at:207:351; Interrogation_Position=685; Antisense; GCAGAAGATCGGACCAACGCTCCAA
>probe:Drosophila_2:1628565_at:90:461; Interrogation_Position=732; Antisense; GATTTCACCACATTTTCGTCTTTAT
>probe:Drosophila_2:1628565_at:264:679; Interrogation_Position=754; Antisense; TATGTATACCCTAGTCCTTCAGTTA

Paste this into a BLAST search page for me
GATCCTTTACGAGGTGTTCCTGCAAAAGCTGGCCCCATCGAAGGAGTGCGGATACCGACCGATAACAATGGGCGTTTTCGGGTTTGTCACATACCAACGCCTAGACTTGTACCAGGGCCTTGAACGAAAGTCACCATCAAGCAGCAGGGCAAGTCGTCTGCGCAATCAGTTCATGGTTCATGATGGAGGCTCTACCGCAGGTCACGCCCGACACAGTTTGCATAACGTACGATCGCAATCCTTTTGGACATTTTGGACACAACGCCGATCAACGGGCAGAAGATCGGACCAACGCTCCAAGATTTCACCACATTTTCGTCTTTATTATGTATACCCTAGTCCTTCAGTTA

Full Affymetrix probeset data:

Annotations for 1628565_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime