FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628567_at:

>probe:Drosophila_2:1628567_at:174:515; Interrogation_Position=103; Antisense; GTGTTCCTGAACTTCATTCACGCAG
>probe:Drosophila_2:1628567_at:192:261; Interrogation_Position=125; Antisense; CAGCGCCCGGTGTGGATATTTCCAA
>probe:Drosophila_2:1628567_at:552:89; Interrogation_Position=15; Antisense; AGTCATCTTCAAATCGCTCCCAAGT
>probe:Drosophila_2:1628567_at:388:243; Interrogation_Position=170; Antisense; AATATCTTTGTGAAGCTGGCTCGAA
>probe:Drosophila_2:1628567_at:226:463; Interrogation_Position=221; Antisense; GATTGATTTCGGCTGCCAATGGACA
>probe:Drosophila_2:1628567_at:71:67; Interrogation_Position=239; Antisense; ATGGACAAACGGTCGTCTGCTACGA
>probe:Drosophila_2:1628567_at:165:433; Interrogation_Position=262; Antisense; GAGTGCAGCCAGTCGGAGTTCAAGA
>probe:Drosophila_2:1628567_at:376:289; Interrogation_Position=315; Antisense; CGGCAAGATCGGGTCTGGCCATCAC
>probe:Drosophila_2:1628567_at:4:507; Interrogation_Position=349; Antisense; GTGCCCTACCTGGTGAGGATGGACC
>probe:Drosophila_2:1628567_at:305:71; Interrogation_Position=45; Antisense; AGGCTAACGGTCAACGGCTGGAATC
>probe:Drosophila_2:1628567_at:461:201; Interrogation_Position=457; Antisense; AACCAGCTCGTCTAGTGATACCTTC
>probe:Drosophila_2:1628567_at:183:457; Interrogation_Position=473; Antisense; GATACCTTCGACAGCGCGTGAATGT
>probe:Drosophila_2:1628567_at:199:681; Interrogation_Position=511; Antisense; TATGGATACGGACTCTGATAGCGGA
>probe:Drosophila_2:1628567_at:273:55; Interrogation_Position=70; Antisense; ATGAATCTATATGTGCTCCTGGCGG

Paste this into a BLAST search page for me
GTGTTCCTGAACTTCATTCACGCAGCAGCGCCCGGTGTGGATATTTCCAAAGTCATCTTCAAATCGCTCCCAAGTAATATCTTTGTGAAGCTGGCTCGAAGATTGATTTCGGCTGCCAATGGACAATGGACAAACGGTCGTCTGCTACGAGAGTGCAGCCAGTCGGAGTTCAAGACGGCAAGATCGGGTCTGGCCATCACGTGCCCTACCTGGTGAGGATGGACCAGGCTAACGGTCAACGGCTGGAATCAACCAGCTCGTCTAGTGATACCTTCGATACCTTCGACAGCGCGTGAATGTTATGGATACGGACTCTGATAGCGGAATGAATCTATATGTGCTCCTGGCGG

Full Affymetrix probeset data:

Annotations for 1628567_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720