Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628570_at:

>probe:Drosophila_2:1628570_at:357:395; Interrogation_Position=1001; Antisense; GAAATCTATGCTTGGAGCACAGTAA
>probe:Drosophila_2:1628570_at:469:183; Interrogation_Position=1078; Antisense; AAAAGCGCACATTACCGCAAACAAT
>probe:Drosophila_2:1628570_at:660:23; Interrogation_Position=549; Antisense; ATACCGGCGGAGTGCCATTCCCGCA
>probe:Drosophila_2:1628570_at:35:639; Interrogation_Position=675; Antisense; TCGGCCAAGAACTTTAAGGGACTCA
>probe:Drosophila_2:1628570_at:355:221; Interrogation_Position=690; Antisense; AAGGGACTCAATCTGGAGGCGTACA
>probe:Drosophila_2:1628570_at:691:437; Interrogation_Position=705; Antisense; GAGGCGTACAGATCTGTCAGGGACA
>probe:Drosophila_2:1628570_at:378:525; Interrogation_Position=736; Antisense; GGGCTTCTAAGTACATCAATCTGAT
>probe:Drosophila_2:1628570_at:549:247; Interrogation_Position=752; Antisense; CAATCTGATTAAGCGGGTTGCGGAA
>probe:Drosophila_2:1628570_at:298:561; Interrogation_Position=773; Antisense; GGAAAATCCGTCCAAAGTCGCCGAT
>probe:Drosophila_2:1628570_at:295:89; Interrogation_Position=865; Antisense; AGTACAGCATACAACGTCCATCAAA
>probe:Drosophila_2:1628570_at:178:667; Interrogation_Position=895; Antisense; TTGCGAAATTTAAACGTCCATATCC
>probe:Drosophila_2:1628570_at:117:265; Interrogation_Position=956; Antisense; CATAAAGTTCTATAAGCCCAATCCT
>probe:Drosophila_2:1628570_at:539:123; Interrogation_Position=970; Antisense; AGCCCAATCCTGGTATAGGCACCTA
>probe:Drosophila_2:1628570_at:465:65; Interrogation_Position=986; Antisense; AGGCACCTACGTTATGAAATCTATG

Paste this into a BLAST search page for me
GAAATCTATGCTTGGAGCACAGTAAAAAAGCGCACATTACCGCAAACAATATACCGGCGGAGTGCCATTCCCGCATCGGCCAAGAACTTTAAGGGACTCAAAGGGACTCAATCTGGAGGCGTACAGAGGCGTACAGATCTGTCAGGGACAGGGCTTCTAAGTACATCAATCTGATCAATCTGATTAAGCGGGTTGCGGAAGGAAAATCCGTCCAAAGTCGCCGATAGTACAGCATACAACGTCCATCAAATTGCGAAATTTAAACGTCCATATCCCATAAAGTTCTATAAGCCCAATCCTAGCCCAATCCTGGTATAGGCACCTAAGGCACCTACGTTATGAAATCTATG

Full Affymetrix probeset data:

Annotations for 1628570_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime