Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628573_a_at:

>probe:Drosophila_2:1628573_a_at:564:155; Interrogation_Position=372; Antisense; ACAGCGGTCTGTCGCTCGGTATCAT
>probe:Drosophila_2:1628573_a_at:389:483; Interrogation_Position=390; Antisense; GTATCATGGCCATCATTGCTGTCAA
>probe:Drosophila_2:1628573_a_at:476:7; Interrogation_Position=404; Antisense; ATTGCTGTCAAGAAGCTCGGCCCGG
>probe:Drosophila_2:1628573_a_at:496:439; Interrogation_Position=491; Antisense; GAGGCTGAGCTGAAGGTCCTCTCCG
>probe:Drosophila_2:1628573_a_at:385:151; Interrogation_Position=591; Antisense; ACATTGCATTGCAGCTGGAGGCCGC
>probe:Drosophila_2:1628573_a_at:584:285; Interrogation_Position=645; Antisense; CGGAGGTGAAGCGTCGTCTCGACTA
>probe:Drosophila_2:1628573_a_at:390:499; Interrogation_Position=660; Antisense; GTCTCGACTACCAGGTGGAGTGCCG
>probe:Drosophila_2:1628573_a_at:561:121; Interrogation_Position=693; Antisense; AGCGTCGCCTTAGCCAGAAGCACAT
>probe:Drosophila_2:1628573_a_at:436:109; Interrogation_Position=708; Antisense; AGAAGCACATGGTCAACTGGATCAC
>probe:Drosophila_2:1628573_a_at:123:545; Interrogation_Position=726; Antisense; GGATCACCACCAATGTGTTGGCCAG
>probe:Drosophila_2:1628573_a_at:125:551; Interrogation_Position=772; Antisense; GGAGACTCTCAACAAGTGCATCGCC
>probe:Drosophila_2:1628573_a_at:435:623; Interrogation_Position=816; Antisense; TGCGCGTCAAGTCTGCCTAAACGAT
>probe:Drosophila_2:1628573_a_at:190:201; Interrogation_Position=871; Antisense; AACCCATTCGAGACGCTGGAACCAT
>probe:Drosophila_2:1628573_a_at:406:333; Interrogation_Position=885; Antisense; GCTGGAACCATGAATATGCCCGAAA

Paste this into a BLAST search page for me
ACAGCGGTCTGTCGCTCGGTATCATGTATCATGGCCATCATTGCTGTCAAATTGCTGTCAAGAAGCTCGGCCCGGGAGGCTGAGCTGAAGGTCCTCTCCGACATTGCATTGCAGCTGGAGGCCGCCGGAGGTGAAGCGTCGTCTCGACTAGTCTCGACTACCAGGTGGAGTGCCGAGCGTCGCCTTAGCCAGAAGCACATAGAAGCACATGGTCAACTGGATCACGGATCACCACCAATGTGTTGGCCAGGGAGACTCTCAACAAGTGCATCGCCTGCGCGTCAAGTCTGCCTAAACGATAACCCATTCGAGACGCTGGAACCATGCTGGAACCATGAATATGCCCGAAA

Full Affymetrix probeset data:

Annotations for 1628573_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime