FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628574_at:

>probe:Drosophila_2:1628574_at:46:53; Interrogation_Position=323; Antisense; ATGCTGCGTGTTAGCCTGTTGTGCA
>probe:Drosophila_2:1628574_at:184:509; Interrogation_Position=343; Antisense; GTGCAGGCAGTTTTCAGTCCTTGGA
>probe:Drosophila_2:1628574_at:157:87; Interrogation_Position=358; Antisense; AGTCCTTGGATTCCTGGAACTCCAG
>probe:Drosophila_2:1628574_at:353:393; Interrogation_Position=426; Antisense; GAAAGCTTGGCGACCAGGCAACATT
>probe:Drosophila_2:1628574_at:428:419; Interrogation_Position=465; Antisense; GAGCTCTGTCTGGAGTGCTTGAACA
>probe:Drosophila_2:1628574_at:652:601; Interrogation_Position=495; Antisense; TGCTTCCTTGATGGTCACGAGTTTT
>probe:Drosophila_2:1628574_at:9:401; Interrogation_Position=525; Antisense; GACATCGAAAAGCTCTGTACCGGTA
>probe:Drosophila_2:1628574_at:238:527; Interrogation_Position=575; Antisense; GGGATCCGCACTGAGTAAGTTCTTC
>probe:Drosophila_2:1628574_at:304:717; Interrogation_Position=597; Antisense; TTCGGCCAGCACTTGCAAACGGGAA
>probe:Drosophila_2:1628574_at:316:287; Interrogation_Position=616; Antisense; CGGGAATTCTTCAGCTTAGGGATCA
>probe:Drosophila_2:1628574_at:453:225; Interrogation_Position=729; Antisense; AAGGACTGCGAAAGTGCCCCGTATG
>probe:Drosophila_2:1628574_at:238:321; Interrogation_Position=744; Antisense; GCCCCGTATGTGCTCAGGATGCGAA
>probe:Drosophila_2:1628574_at:175:145; Interrogation_Position=787; Antisense; ACTGCATGCTCATCACATTGGACGA
>probe:Drosophila_2:1628574_at:365:161; Interrogation_Position=820; Antisense; ACAATGTGCCCTTCAGGATCTACAA

Paste this into a BLAST search page for me
ATGCTGCGTGTTAGCCTGTTGTGCAGTGCAGGCAGTTTTCAGTCCTTGGAAGTCCTTGGATTCCTGGAACTCCAGGAAAGCTTGGCGACCAGGCAACATTGAGCTCTGTCTGGAGTGCTTGAACATGCTTCCTTGATGGTCACGAGTTTTGACATCGAAAAGCTCTGTACCGGTAGGGATCCGCACTGAGTAAGTTCTTCTTCGGCCAGCACTTGCAAACGGGAACGGGAATTCTTCAGCTTAGGGATCAAAGGACTGCGAAAGTGCCCCGTATGGCCCCGTATGTGCTCAGGATGCGAAACTGCATGCTCATCACATTGGACGAACAATGTGCCCTTCAGGATCTACAA

Full Affymetrix probeset data:

Annotations for 1628574_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720