FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628578_at:

>probe:Drosophila_2:1628578_at:712:669; Interrogation_Position=373; Antisense; TACGGTCATGCGGAAGTCAGCTATT
>probe:Drosophila_2:1628578_at:684:387; Interrogation_Position=403; Antisense; GAAAAGTACTTCTGCATGACCACGA
>probe:Drosophila_2:1628578_at:340:439; Interrogation_Position=433; Antisense; GAGGCCCTGAGGAAGCAACTCGATC
>probe:Drosophila_2:1628578_at:19:639; Interrogation_Position=452; Antisense; TCGATCACTGGTTTGACCCCAATAG
>probe:Drosophila_2:1628578_at:172:379; Interrogation_Position=492; Antisense; GAAGCTGTTCTTCTCATGGACTAAA
>probe:Drosophila_2:1628578_at:464:25; Interrogation_Position=586; Antisense; ATAGTTGAGTATGTTCGGCCAGCAC
>probe:Drosophila_2:1628578_at:265:287; Interrogation_Position=610; Antisense; CTGGTCCACCAGTTGCTAAAGTGCG
>probe:Drosophila_2:1628578_at:107:221; Interrogation_Position=628; Antisense; AAGTGCGTCTACAACTGCGGAGTGA
>probe:Drosophila_2:1628578_at:574:437; Interrogation_Position=685; Antisense; GAGGACACCGACGAAGAAGCCGCTT
>probe:Drosophila_2:1628578_at:607:97; Interrogation_Position=759; Antisense; AGATGAGCTCGTGAAGACCTGCAAT
>probe:Drosophila_2:1628578_at:399:227; Interrogation_Position=781; Antisense; AATGGTGGCTCACTTTTCGTCGAAC
>probe:Drosophila_2:1628578_at:415:53; Interrogation_Position=854; Antisense; ATGAATTCGAGACCACCGTGTTCAC
>probe:Drosophila_2:1628578_at:102:515; Interrogation_Position=871; Antisense; GTGTTCACACTTCCAACGTACGATC
>probe:Drosophila_2:1628578_at:407:63; Interrogation_Position=902; Antisense; ATGTGTTGCCAACGCTACCAGACAA

Paste this into a BLAST search page for me
TACGGTCATGCGGAAGTCAGCTATTGAAAAGTACTTCTGCATGACCACGAGAGGCCCTGAGGAAGCAACTCGATCTCGATCACTGGTTTGACCCCAATAGGAAGCTGTTCTTCTCATGGACTAAAATAGTTGAGTATGTTCGGCCAGCACCTGGTCCACCAGTTGCTAAAGTGCGAAGTGCGTCTACAACTGCGGAGTGAGAGGACACCGACGAAGAAGCCGCTTAGATGAGCTCGTGAAGACCTGCAATAATGGTGGCTCACTTTTCGTCGAACATGAATTCGAGACCACCGTGTTCACGTGTTCACACTTCCAACGTACGATCATGTGTTGCCAACGCTACCAGACAA

Full Affymetrix probeset data:

Annotations for 1628578_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720