Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628582_at:

>probe:Drosophila_2:1628582_at:469:43; Interrogation_Position=3611; Antisense; ATCGCTATCACAGTGACGAGGCACT
>probe:Drosophila_2:1628582_at:497:33; Interrogation_Position=3617; Antisense; ATCACAGTGACGAGGCACTGCTGGA
>probe:Drosophila_2:1628582_at:626:431; Interrogation_Position=3640; Antisense; GAGGTGGACTCCTACACGGGACTGC
>probe:Drosophila_2:1628582_at:333:143; Interrogation_Position=3660; Antisense; ACTGCGCCGTTCCTCGGGAGGATCC
>probe:Drosophila_2:1628582_at:183:529; Interrogation_Position=3675; Antisense; GGGAGGATCCACACAGTCGCGCTAT
>probe:Drosophila_2:1628582_at:724:445; Interrogation_Position=3680; Antisense; GATCCACACAGTCGCGCTATGAGGA
>probe:Drosophila_2:1628582_at:332:635; Interrogation_Position=3691; Antisense; TCGCGCTATGAGGAGACGACCCTAT
>probe:Drosophila_2:1628582_at:332:57; Interrogation_Position=3698; Antisense; ATGAGGAGACGACCCTATCGCTGAC
>probe:Drosophila_2:1628582_at:196:611; Interrogation_Position=3719; Antisense; TGACCCTGTCCTGCCAAAGTATTGA
>probe:Drosophila_2:1628582_at:95:505; Interrogation_Position=3726; Antisense; GTCCTGCCAAAGTATTGAAATCGTG
>probe:Drosophila_2:1628582_at:138:395; Interrogation_Position=3742; Antisense; GAAATCGTGGGTGGTCAACATAATA
>probe:Drosophila_2:1628582_at:162:655; Interrogation_Position=3762; Antisense; TAATAAAAGGCGACCCTCCTCTTAT
>probe:Drosophila_2:1628582_at:713:627; Interrogation_Position=3792; Antisense; TGCCAATACGCCACTGCTGATGAAC
>probe:Drosophila_2:1628582_at:388:259; Interrogation_Position=3803; Antisense; CACTGCTGATGAACCACGTGGAGGT

Paste this into a BLAST search page for me
ATCGCTATCACAGTGACGAGGCACTATCACAGTGACGAGGCACTGCTGGAGAGGTGGACTCCTACACGGGACTGCACTGCGCCGTTCCTCGGGAGGATCCGGGAGGATCCACACAGTCGCGCTATGATCCACACAGTCGCGCTATGAGGATCGCGCTATGAGGAGACGACCCTATATGAGGAGACGACCCTATCGCTGACTGACCCTGTCCTGCCAAAGTATTGAGTCCTGCCAAAGTATTGAAATCGTGGAAATCGTGGGTGGTCAACATAATATAATAAAAGGCGACCCTCCTCTTATTGCCAATACGCCACTGCTGATGAACCACTGCTGATGAACCACGTGGAGGT

Full Affymetrix probeset data:

Annotations for 1628582_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime