FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628584_at:

>probe:Drosophila_2:1628584_at:520:315; Interrogation_Position=1208; Antisense; GCCTTTGACTACATGGATGCCTTCA
>probe:Drosophila_2:1628584_at:606:713; Interrogation_Position=1229; Antisense; TTCATCATGGAGGTGCAGCGCTTCT
>probe:Drosophila_2:1628584_at:625:1; Interrogation_Position=1268; Antisense; ATTACGGGTCCACGCAGAGCTTTGT
>probe:Drosophila_2:1628584_at:401:287; Interrogation_Position=1304; Antisense; CTGGGTGGCTACGACATTCCGAAAA
>probe:Drosophila_2:1628584_at:46:313; Interrogation_Position=1331; Antisense; GCCACAATTCTGATTAGCCTACGTT
>probe:Drosophila_2:1628584_at:271:307; Interrogation_Position=1348; Antisense; CCTACGTTCAGTGCATCTCGATAAG
>probe:Drosophila_2:1628584_at:610:469; Interrogation_Position=1396; Antisense; GTTCCGCCCAGAGAGGTTCATCGAT
>probe:Drosophila_2:1628584_at:241:43; Interrogation_Position=1415; Antisense; ATCGATTCGGCTGGCAAGTGCTTCA
>probe:Drosophila_2:1628584_at:169:225; Interrogation_Position=1439; Antisense; AAGGACGAGTACTTCATGCCCTTCG
>probe:Drosophila_2:1628584_at:225:347; Interrogation_Position=1509; Antisense; GCATCTTCTCGTTTCTAGTGCGGAT
>probe:Drosophila_2:1628584_at:102:639; Interrogation_Position=1533; Antisense; TCGTGCAGCATTTTAGCGTTGTCCT
>probe:Drosophila_2:1628584_at:289:251; Interrogation_Position=1578; Antisense; CAATGGTGCTTCTGCCTGGGATTAC
>probe:Drosophila_2:1628584_at:316:459; Interrogation_Position=1597; Antisense; GATTACGCTTACTCCAAAACCATAC
>probe:Drosophila_2:1628584_at:562:201; Interrogation_Position=1637; Antisense; AAGCGCACCTAAGTTCGTGACTGGA

Paste this into a BLAST search page for me
GCCTTTGACTACATGGATGCCTTCATTCATCATGGAGGTGCAGCGCTTCTATTACGGGTCCACGCAGAGCTTTGTCTGGGTGGCTACGACATTCCGAAAAGCCACAATTCTGATTAGCCTACGTTCCTACGTTCAGTGCATCTCGATAAGGTTCCGCCCAGAGAGGTTCATCGATATCGATTCGGCTGGCAAGTGCTTCAAAGGACGAGTACTTCATGCCCTTCGGCATCTTCTCGTTTCTAGTGCGGATTCGTGCAGCATTTTAGCGTTGTCCTCAATGGTGCTTCTGCCTGGGATTACGATTACGCTTACTCCAAAACCATACAAGCGCACCTAAGTTCGTGACTGGA

Full Affymetrix probeset data:

Annotations for 1628584_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720