FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628586_at:

>probe:Drosophila_2:1628586_at:567:339; Interrogation_Position=104; Antisense; GCTACATGATCCACATGCTCATACG
>probe:Drosophila_2:1628586_at:101:29; Interrogation_Position=124; Antisense; ATACGCCTGCATCATTTGTGGAACC
>probe:Drosophila_2:1628586_at:527:593; Interrogation_Position=140; Antisense; TGTGGAACCTGGAGGGCCTGTCCAT
>probe:Drosophila_2:1628586_at:657:663; Interrogation_Position=175; Antisense; TACGTTTTGGCGGTGTCCGCTGAAT
>probe:Drosophila_2:1628586_at:71:669; Interrogation_Position=220; Antisense; TACTCGGTGAACCTGTGCTCTGGCG
>probe:Drosophila_2:1628586_at:240:63; Interrogation_Position=253; Antisense; ATGTGGATGCTGCTCACCGTGACAC
>probe:Drosophila_2:1628586_at:359:555; Interrogation_Position=325; Antisense; GGACGCAGTTTGTGGCTACGCATCA
>probe:Drosophila_2:1628586_at:283:381; Interrogation_Position=354; Antisense; GAACGCCGTGTTCGCGCTAATAGTT
>probe:Drosophila_2:1628586_at:378:677; Interrogation_Position=374; Antisense; TAGTTCTCGAGGTGATCGTGTCTCT
>probe:Drosophila_2:1628586_at:513:599; Interrogation_Position=392; Antisense; TGTCTCTGGTGCACTTTGTTATCTG
>probe:Drosophila_2:1628586_at:150:727; Interrogation_Position=407; Antisense; TTGTTATCTGCAAGCCAGGCTGTAA
>probe:Drosophila_2:1628586_at:672:625; Interrogation_Position=434; Antisense; TGCCGCTGCCGCTAGAAGGGAACGA
>probe:Drosophila_2:1628586_at:103:285; Interrogation_Position=61; Antisense; CTGCTGCAGGCCAACACGTATGTGT
>probe:Drosophila_2:1628586_at:376:139; Interrogation_Position=76; Antisense; ACGTATGTGTCCATGGTGTGGGCCA

Paste this into a BLAST search page for me
GCTACATGATCCACATGCTCATACGATACGCCTGCATCATTTGTGGAACCTGTGGAACCTGGAGGGCCTGTCCATTACGTTTTGGCGGTGTCCGCTGAATTACTCGGTGAACCTGTGCTCTGGCGATGTGGATGCTGCTCACCGTGACACGGACGCAGTTTGTGGCTACGCATCAGAACGCCGTGTTCGCGCTAATAGTTTAGTTCTCGAGGTGATCGTGTCTCTTGTCTCTGGTGCACTTTGTTATCTGTTGTTATCTGCAAGCCAGGCTGTAATGCCGCTGCCGCTAGAAGGGAACGACTGCTGCAGGCCAACACGTATGTGTACGTATGTGTCCATGGTGTGGGCCA

Full Affymetrix probeset data:

Annotations for 1628586_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720