FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628587_at:

>probe:Drosophila_2:1628587_at:491:95; Interrogation_Position=356; Antisense; AGATTCCGTGTGGTGTCCAAGTGCT
>probe:Drosophila_2:1628587_at:93:221; Interrogation_Position=374; Antisense; AAGTGCTCGCCTGCGGCAATAAACA
>probe:Drosophila_2:1628587_at:571:265; Interrogation_Position=420; Antisense; CAGTCAGCTGCAGTTTATACGCGCT
>probe:Drosophila_2:1628587_at:408:687; Interrogation_Position=435; Antisense; TATACGCGCTGAGGGATTCGTCTTT
>probe:Drosophila_2:1628587_at:141:19; Interrogation_Position=503; Antisense; ATTTGCTGCGCTACCGGAAGCTCAT
>probe:Drosophila_2:1628587_at:249:63; Interrogation_Position=539; Antisense; ATGTGCTCATCTTCACGGATCTGAA
>probe:Drosophila_2:1628587_at:31:377; Interrogation_Position=564; Antisense; GAAGAAGCACAGCTCACATGCCATA
>probe:Drosophila_2:1628587_at:594:441; Interrogation_Position=595; Antisense; GATGTCAGTCTCTTGGAAACGGCCC
>probe:Drosophila_2:1628587_at:643:567; Interrogation_Position=624; Antisense; GGCAGAGTTCTTCATGACCGATGGT
>probe:Drosophila_2:1628587_at:19:273; Interrogation_Position=654; Antisense; CATTACGGGTACAGCGACGGGTCAT
>probe:Drosophila_2:1628587_at:412:87; Interrogation_Position=685; Antisense; AGTCCCGAAGATCTGCAGCAGCTAT
>probe:Drosophila_2:1628587_at:593:617; Interrogation_Position=698; Antisense; TGCAGCAGCTATCCGGCAGGGTTAA
>probe:Drosophila_2:1628587_at:422:223; Interrogation_Position=721; Antisense; AAGGTTCCCCTGATAATTGGCTCTG
>probe:Drosophila_2:1628587_at:650:171; Interrogation_Position=873; Antisense; AAAGATTTGCCAACTGCGACACTCG

Paste this into a BLAST search page for me
AGATTCCGTGTGGTGTCCAAGTGCTAAGTGCTCGCCTGCGGCAATAAACACAGTCAGCTGCAGTTTATACGCGCTTATACGCGCTGAGGGATTCGTCTTTATTTGCTGCGCTACCGGAAGCTCATATGTGCTCATCTTCACGGATCTGAAGAAGAAGCACAGCTCACATGCCATAGATGTCAGTCTCTTGGAAACGGCCCGGCAGAGTTCTTCATGACCGATGGTCATTACGGGTACAGCGACGGGTCATAGTCCCGAAGATCTGCAGCAGCTATTGCAGCAGCTATCCGGCAGGGTTAAAAGGTTCCCCTGATAATTGGCTCTGAAAGATTTGCCAACTGCGACACTCG

Full Affymetrix probeset data:

Annotations for 1628587_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720