FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628588_at:

>probe:Drosophila_2:1628588_at:642:325; Interrogation_Position=1021; Antisense; GCGAGATAATATTCACCAACCAGGT
>probe:Drosophila_2:1628588_at:353:715; Interrogation_Position=529; Antisense; TTGCGGTAGCGGATCTCGTTGGCCA
>probe:Drosophila_2:1628588_at:639:405; Interrogation_Position=562; Antisense; GACTGACCGGCATCAACAAGGTTTG
>probe:Drosophila_2:1628588_at:706:223; Interrogation_Position=579; Antisense; AAGGTTTGTGAGTGCGTCTTTGCCT
>probe:Drosophila_2:1628588_at:196:385; Interrogation_Position=630; Antisense; GAACTCAAACATTCTGCCAGGAACA
>probe:Drosophila_2:1628588_at:223:539; Interrogation_Position=663; Antisense; GGTAGCCTCAGCGAACTTATAGACT
>probe:Drosophila_2:1628588_at:410:39; Interrogation_Position=738; Antisense; ATCTCCTTCGATCTACTGCAGTATT
>probe:Drosophila_2:1628588_at:730:19; Interrogation_Position=760; Antisense; ATTTGTTGTGCTGCCTTAGCGAGTA
>probe:Drosophila_2:1628588_at:40:707; Interrogation_Position=775; Antisense; TTAGCGAGTACGTACAACCGCAGGT
>probe:Drosophila_2:1628588_at:464:201; Interrogation_Position=790; Antisense; AACCGCAGGTGGAAGCACAGTTTTT
>probe:Drosophila_2:1628588_at:624:207; Interrogation_Position=819; Antisense; AAGCTTCGTGAGGAGTTTCCGCGCC
>probe:Drosophila_2:1628588_at:632:697; Interrogation_Position=874; Antisense; TTTACGGCTCGACGACGGCGACGAT
>probe:Drosophila_2:1628588_at:727:439; Interrogation_Position=930; Antisense; GAGGCCGAAGCGACGACTAATAGCA
>probe:Drosophila_2:1628588_at:472:359; Interrogation_Position=952; Antisense; GCAACAGCTCCAGTTTCGAAGCAGA

Paste this into a BLAST search page for me
GCGAGATAATATTCACCAACCAGGTTTGCGGTAGCGGATCTCGTTGGCCAGACTGACCGGCATCAACAAGGTTTGAAGGTTTGTGAGTGCGTCTTTGCCTGAACTCAAACATTCTGCCAGGAACAGGTAGCCTCAGCGAACTTATAGACTATCTCCTTCGATCTACTGCAGTATTATTTGTTGTGCTGCCTTAGCGAGTATTAGCGAGTACGTACAACCGCAGGTAACCGCAGGTGGAAGCACAGTTTTTAAGCTTCGTGAGGAGTTTCCGCGCCTTTACGGCTCGACGACGGCGACGATGAGGCCGAAGCGACGACTAATAGCAGCAACAGCTCCAGTTTCGAAGCAGA

Full Affymetrix probeset data:

Annotations for 1628588_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720