FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628589_at:

>probe:Drosophila_2:1628589_at:7:649; Interrogation_Position=375; Antisense; TCATGGATTGACCTCGCTGTTCAGC
>probe:Drosophila_2:1628589_at:301:323; Interrogation_Position=509; Antisense; GCGCCTGGGAGCTCAAACAGTTCAT
>probe:Drosophila_2:1628589_at:686:177; Interrogation_Position=523; Antisense; AAACAGTTCATCCAGTGCGCCCAGG
>probe:Drosophila_2:1628589_at:217:413; Interrogation_Position=556; Antisense; GATCTTACCCTCTGCGAGGGATTCA
>probe:Drosophila_2:1628589_at:716:651; Interrogation_Position=578; Antisense; TCAACGAGGCGCTGCGGCAGTGCAA
>probe:Drosophila_2:1628589_at:116:81; Interrogation_Position=605; Antisense; AGAGCCACCATCTCCAGTAGAGGGC
>probe:Drosophila_2:1628589_at:11:91; Interrogation_Position=620; Antisense; AGTAGAGGGCCCAGCTCCGGTAGAA
>probe:Drosophila_2:1628589_at:83:337; Interrogation_Position=633; Antisense; GCTCCGGTAGAATATCATCTGGCCA
>probe:Drosophila_2:1628589_at:585:39; Interrogation_Position=649; Antisense; ATCTGGCCAAGCACCGGCGGATGAA
>probe:Drosophila_2:1628589_at:5:615; Interrogation_Position=670; Antisense; TGAACGCAGCCGGATGAACCCATCG
>probe:Drosophila_2:1628589_at:214:547; Interrogation_Position=694; Antisense; GGATGAACACCTCCGGATGAACTCT
>probe:Drosophila_2:1628589_at:452:671; Interrogation_Position=723; Antisense; TATCCCTTCGTTTAGTTCTTAATTG
>probe:Drosophila_2:1628589_at:570:23; Interrogation_Position=808; Antisense; ATAGAAAATCCCGTTGGCAGCCCAA
>probe:Drosophila_2:1628589_at:501:259; Interrogation_Position=886; Antisense; CACGGGTTGTCAATGTGGGCCAAAA

Paste this into a BLAST search page for me
TCATGGATTGACCTCGCTGTTCAGCGCGCCTGGGAGCTCAAACAGTTCATAAACAGTTCATCCAGTGCGCCCAGGGATCTTACCCTCTGCGAGGGATTCATCAACGAGGCGCTGCGGCAGTGCAAAGAGCCACCATCTCCAGTAGAGGGCAGTAGAGGGCCCAGCTCCGGTAGAAGCTCCGGTAGAATATCATCTGGCCAATCTGGCCAAGCACCGGCGGATGAATGAACGCAGCCGGATGAACCCATCGGGATGAACACCTCCGGATGAACTCTTATCCCTTCGTTTAGTTCTTAATTGATAGAAAATCCCGTTGGCAGCCCAACACGGGTTGTCAATGTGGGCCAAAA

Full Affymetrix probeset data:

Annotations for 1628589_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720